EMAIL THIS PAGE TO A FRIEND

RETN

resistin

61 Gene Product Result for
Synonyms: ADSF FIZZ3 RETN1 RSTN XCP1
UniProtKB ID: Q9HD89, D6W649, Q540D9
Gene ID:
Human(56729) Summary: This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(57264) resistin
Rat(246250) resistin
fruit fly(45976) retained
dog(611540) resistin
cow(369020) resistin
sheep(101122857) resistin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R1904 Anti-Resistin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1407746 Anti-RETN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412242 ANTI-RETN antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412243 ANTI-RETN antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412378 ANTI-RETN antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412379 ANTI-RETN antibody produced in mouse clone 4C8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412380 ANTI-RETN antibody produced in mouse clone 6H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412381 ANTI-RETN antibody produced in mouse clone 4H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412382 ANTI-RETN antibody produced in mouse clone 6C3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1411111 Anti-RETN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0056729M4 Monoclonal Anti-RETN antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1405190 Monoclonal Anti-RETN antibody produced in mouse clone 5E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020415 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139501 MISSION® esiRNA esiRNA human RETN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020415 Rosetta Predictions human pricing
NM_144741 Rosetta Predictions rat pricing
NM_022984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027406 predicted 173
2 SASI_Hs01_00027408 predicted 247
3 SASI_Hs01_00027409 predicted 186
4 SASI_Hs02_00353417 predicted 315
5 SASI_Hs01_00027410 predicted 150
6 SASI_Hs01_00027411 predicted 121
7 SASI_Hs01_00027412 predicted 148
8 SASI_Hs01_00027413 predicted 239
9 SASI_Hs01_00027414 predicted 293
10 SASI_Hs01_00027415 predicted 265
11 SASI_Hs01_00027407 predicted 153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040845 predicted 327
2 SASI_Rn01_00040846 predicted 353
3 SASI_Rn01_00040847 predicted 342
4 SASI_Rn01_00040848 predicted 226
5 SASI_Rn01_00040849 predicted 358
6 SASI_Rn01_00040850 predicted 291
7 SASI_Rn01_00040851 predicted 283
8 SASI_Rn01_00040852 predicted 267
9 SASI_Rn01_00040853 predicted 227
10 SASI_Rn01_00040854 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163555 predicted 397
2 SASI_Mm01_00163556 predicted 894
3 SASI_Mm01_00163558 predicted 664
4 SASI_Mm01_00163559 predicted 416
5 SASI_Mm01_00163560 predicted 203
6 SASI_Mm02_00326708 predicted 750
7 SASI_Mm01_00163561 predicted 700
8 SASI_Mm01_00163562 predicted 400
9 SASI_Mm01_00163563 predicted 570
10 SASI_Mm01_00163564 predicted 437
11 SASI_Mm01_00163557 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022984
RETN MISSION shRNA Bacterial Glycerol Stock
resistin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-164s1c1
Sequence:CCGGCAAGAAGATCAAACAAGACTTCTCGAGAAGTCTTGTTTGATCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-220s1c1
Sequence:CCGGGCTTAAATTGCTGGACAGTCTCTCGAGAGACTGTCCAGCAATTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-190s1c1
Sequence:CCGGCCCTGTTTCCAAATGCAATAACTCGAGTTATTGCATTTGGAAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-135s21c1
Sequence:CCGGCCACTGTGTCCCATCGATGAACTCGAGTTCATCGATGGGACACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-157s21c1
Sequence:CCGGCCATCGACAAGAAGATCAAACCTCGAGGTTTGATCTTCTTGTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-315s21c1
Sequence:CCGGTCGTGGGACATTCGTGAAGAACTCGAGTTCTTCACGAATGTCCCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-205s21c1
Sequence:CCGGCAATAAAGAACATTGGCTTAACTCGAGTTAAGCCAATGTTCTTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022984.3-896s21c1
Sequence:CCGGTATAGCCTGGGTGCTAGTAACCTCGAGGTTACTAGCACCCAGGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022984
RETN MISSION shRNA shRNA Plasmid DNA
resistin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-164s1c1
Sequence:CCGGCAAGAAGATCAAACAAGACTTCTCGAGAAGTCTTGTTTGATCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-220s1c1
Sequence:CCGGGCTTAAATTGCTGGACAGTCTCTCGAGAGACTGTCCAGCAATTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-190s1c1
Sequence:CCGGCCCTGTTTCCAAATGCAATAACTCGAGTTATTGCATTTGGAAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-135s21c1
Sequence:CCGGCCACTGTGTCCCATCGATGAACTCGAGTTCATCGATGGGACACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-157s21c1
Sequence:CCGGCCATCGACAAGAAGATCAAACCTCGAGGTTTGATCTTCTTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-315s21c1
Sequence:CCGGTCGTGGGACATTCGTGAAGAACTCGAGTTCTTCACGAATGTCCCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-205s21c1
Sequence:CCGGCAATAAAGAACATTGGCTTAACTCGAGTTAAGCCAATGTTCTTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022984.3-896s21c1
Sequence:CCGGTATAGCCTGGGTGCTAGTAACCTCGAGGTTACTAGCACCCAGGCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022984
RETN MISSION shRNA Lentiviral Transduction Particles
resistin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-164s1c1
Sequence:CCGGCAAGAAGATCAAACAAGACTTCTCGAGAAGTCTTGTTTGATCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-220s1c1
Sequence:CCGGGCTTAAATTGCTGGACAGTCTCTCGAGAGACTGTCCAGCAATTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022984.3-190s1c1
Sequence:CCGGCCCTGTTTCCAAATGCAATAACTCGAGTTATTGCATTTGGAAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-135s21c1
Sequence:CCGGCCACTGTGTCCCATCGATGAACTCGAGTTCATCGATGGGACACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-157s21c1
Sequence:CCGGCCATCGACAAGAAGATCAAACCTCGAGGTTTGATCTTCTTGTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-315s21c1
Sequence:CCGGTCGTGGGACATTCGTGAAGAACTCGAGTTCTTCACGAATGTCCCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022984.3-205s21c1
Sequence:CCGGCAATAAAGAACATTGGCTTAACTCGAGTTAAGCCAATGTTCTTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022984.3-896s21c1
Sequence:CCGGTATAGCCTGGGTGCTAGTAACCTCGAGGTTACTAGCACCCAGGCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020415
RETN MISSION shRNA Bacterial Glycerol Stock
resistin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-157s1c1
Sequence:CCGGCTCCCTAATATTTAGGGCAATCTCGAGATTGCCCTAAATATTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-122s1c1
Sequence:CCGGGAAGCCATCAATGAGAGGATCCTCGAGGATCCTCTCATTGATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-156s1c1
Sequence:CCGGGCTCCCTAATATTTAGGGCAACTCGAGTTGCCCTAAATATTAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-104s21c1
Sequence:CCGGACCCTGTGCTCCATGGAAGAACTCGAGTTCTTCCATGGAGCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-112s21c1
Sequence:CCGGCTCCATGGAAGAAGCCATCAACTCGAGTTGATGGCTTCTTCCATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-176s21c1
Sequence:CCGGATAAGCAGCATTGGCCTGGAGCTCGAGCTCCAGGCCAATGCTGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-93s21c1
Sequence:CCGGTGTCTAGCAAGACCCTGTGCTCTCGAGAGCACAGGGTCTTGCTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-168s1c1
Sequence:CCGGTTAGGGCAATAAGCAGCATTGCTCGAGCAATGCTGCTTATTGCCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-85s1c1
Sequence:CCGGGCTGTTGGTGTCTAGCAAGACCTCGAGGTCTTGCTAGACACCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020415
RETN MISSION shRNA shRNA Plasmid DNA
resistin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-157s1c1
Sequence:CCGGCTCCCTAATATTTAGGGCAATCTCGAGATTGCCCTAAATATTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-122s1c1
Sequence:CCGGGAAGCCATCAATGAGAGGATCCTCGAGGATCCTCTCATTGATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-156s1c1
Sequence:CCGGGCTCCCTAATATTTAGGGCAACTCGAGTTGCCCTAAATATTAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-104s21c1
Sequence:CCGGACCCTGTGCTCCATGGAAGAACTCGAGTTCTTCCATGGAGCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-112s21c1
Sequence:CCGGCTCCATGGAAGAAGCCATCAACTCGAGTTGATGGCTTCTTCCATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-176s21c1
Sequence:CCGGATAAGCAGCATTGGCCTGGAGCTCGAGCTCCAGGCCAATGCTGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-93s21c1
Sequence:CCGGTGTCTAGCAAGACCCTGTGCTCTCGAGAGCACAGGGTCTTGCTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-168s1c1
Sequence:CCGGTTAGGGCAATAAGCAGCATTGCTCGAGCAATGCTGCTTATTGCCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-85s1c1
Sequence:CCGGGCTGTTGGTGTCTAGCAAGACCTCGAGGTCTTGCTAGACACCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020415
RETN MISSION shRNA Lentiviral Transduction Particles
resistin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-157s1c1
Sequence:CCGGCTCCCTAATATTTAGGGCAATCTCGAGATTGCCCTAAATATTAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-122s1c1
Sequence:CCGGGAAGCCATCAATGAGAGGATCCTCGAGGATCCTCTCATTGATGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-156s1c1
Sequence:CCGGGCTCCCTAATATTTAGGGCAACTCGAGTTGCCCTAAATATTAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-104s21c1
Sequence:CCGGACCCTGTGCTCCATGGAAGAACTCGAGTTCTTCCATGGAGCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-112s21c1
Sequence:CCGGCTCCATGGAAGAAGCCATCAACTCGAGTTGATGGCTTCTTCCATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-176s21c1
Sequence:CCGGATAAGCAGCATTGGCCTGGAGCTCGAGCTCCAGGCCAATGCTGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020415.2-93s21c1
Sequence:CCGGTGTCTAGCAAGACCCTGTGCTCTCGAGAGCACAGGGTCTTGCTAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-168s1c1
Sequence:CCGGTTAGGGCAATAAGCAGCATTGCTCGAGCAATGCTGCTTATTGCCCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020415.2-85s1c1
Sequence:CCGGGCTGTTGGTGTCTAGCAAGACCTCGAGGTCTTGCTAGACACCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)