EMAIL THIS PAGE TO A FRIEND

RETNLB

resistin like beta

66 Gene Product Result for
Synonyms: FIZZ1 FIZZ2 HXCP2 RELM-beta RELMb RELMbeta XCP2
UniProtKB ID: Q9BQ08, Q14D27
Gene ID:
Mouse(57263) resistin like beta
Rat(498074) resistin like beta
sheep(101112191) resistin like beta
dog(100684690) resistin like beta
domestic cat(101081749) resistin like beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU177241 MISSION® esiRNA esiRNA targeting mouse Retnlb mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032579 Rosetta Predictions human pricing
NM_001024281 Rosetta Predictions rat pricing
NM_023881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194523 predicted 246
2 SASI_Hs01_00194524 predicted 219
3 SASI_Hs01_00194526 predicted 253
4 SASI_Hs01_00194527 predicted 221
5 SASI_Hs01_00194529 predicted 255
6 SASI_Hs02_00360101 predicted 291
7 SASI_Hs02_00360102 predicted 329
8 SASI_Hs02_00360103 predicted 251
9 SASI_Hs02_00360104 predicted 225
10 SASI_Hs02_00360105 predicted 337
11 SASI_Hs01_00194525 predicted 205
12 SASI_Hs01_00194528 predicted 507
13 SASI_Hs01_00194530 predicted 494
14 SASI_Hs01_00194531 predicted 460
15 SASI_Hs01_00194532 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067591 predicted 216
2 SASI_Rn01_00067593 predicted 246
3 SASI_Rn01_00067594 predicted 235
4 SASI_Rn01_00067595 predicted 245
5 SASI_Rn01_00067596 predicted 234
6 SASI_Rn01_00067597 predicted 246
7 SASI_Rn01_00067599 predicted 227
8 SASI_Rn01_00067600 predicted 231
9 SASI_Rn02_00202462 predicted 248
10 SASI_Rn02_00202463 predicted 443
11 SASI_Rn01_00067592 predicted 227
12 SASI_Rn01_00067598 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061289 predicted 243
2 SASI_Mm01_00061290 predicted 308
3 SASI_Mm01_00061291 predicted 305
4 SASI_Mm01_00061292 predicted 303
5 SASI_Mm01_00061293 predicted 340
6 SASI_Mm01_00061295 predicted 318
7 SASI_Mm01_00061296 predicted 385
8 SASI_Mm02_00327431 predicted 321
9 SASI_Mm01_00061297 predicted 380
10 SASI_Mm02_00327432 predicted 364
11 SASI_Mm01_00061294 predicted 424
12 SASI_Mm01_00061298 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023881
RETNLB MISSION shRNA Bacterial Glycerol Stock
resistin like beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-437s21c1
Sequence:CCGGGGTTGTCACTGGATGTGCTTGCTCGAGCAAGCACATCCAGTGACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-359s21c1
Sequence:CCGGCAGTCGTCAAGAGCCTAAGACCTCGAGGTCTTAGGCTCTTGACGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-311s1c1
Sequence:CCGGCGCAATGCTCCTTTGAGTCTTCTCGAGAAGACTCAAAGGAGCATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023881.3-568s21c1
Sequence:CCGGGAGGTTGAGAAACCAATTTCACTCGAGTGAAATTGGTTTCTCAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-540s21c1
Sequence:CCGGCGCTGCTGCCGAATGGTTTAACTCGAGTTAAACCATTCGGCAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-321s1c1
Sequence:CCGGCTTTGAGTCTTTGGTGGATCACTCGAGTGATCCACCAAAGACTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-374s1c1
Sequence:CCGGCTAAGACGATCTCCTGCACTACTCGAGTAGTGCAGGAGATCGTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-312s21c1
Sequence:CCGGCAATGCTCCTTTGAGTCTTTGCTCGAGCAAAGACTCAAAGGAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023881
RETNLB MISSION shRNA shRNA Plasmid DNA
resistin like beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-437s21c1
Sequence:CCGGGGTTGTCACTGGATGTGCTTGCTCGAGCAAGCACATCCAGTGACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-359s21c1
Sequence:CCGGCAGTCGTCAAGAGCCTAAGACCTCGAGGTCTTAGGCTCTTGACGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-311s1c1
Sequence:CCGGCGCAATGCTCCTTTGAGTCTTCTCGAGAAGACTCAAAGGAGCATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023881.3-568s21c1
Sequence:CCGGGAGGTTGAGAAACCAATTTCACTCGAGTGAAATTGGTTTCTCAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-540s21c1
Sequence:CCGGCGCTGCTGCCGAATGGTTTAACTCGAGTTAAACCATTCGGCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-321s1c1
Sequence:CCGGCTTTGAGTCTTTGGTGGATCACTCGAGTGATCCACCAAAGACTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-374s1c1
Sequence:CCGGCTAAGACGATCTCCTGCACTACTCGAGTAGTGCAGGAGATCGTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-312s21c1
Sequence:CCGGCAATGCTCCTTTGAGTCTTTGCTCGAGCAAAGACTCAAAGGAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023881
RETNLB MISSION shRNA Lentiviral Transduction Particles
resistin like beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-437s21c1
Sequence:CCGGGGTTGTCACTGGATGTGCTTGCTCGAGCAAGCACATCCAGTGACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-359s21c1
Sequence:CCGGCAGTCGTCAAGAGCCTAAGACCTCGAGGTCTTAGGCTCTTGACGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-311s1c1
Sequence:CCGGCGCAATGCTCCTTTGAGTCTTCTCGAGAAGACTCAAAGGAGCATTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023881.3-568s21c1
Sequence:CCGGGAGGTTGAGAAACCAATTTCACTCGAGTGAAATTGGTTTCTCAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-540s21c1
Sequence:CCGGCGCTGCTGCCGAATGGTTTAACTCGAGTTAAACCATTCGGCAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-321s1c1
Sequence:CCGGCTTTGAGTCTTTGGTGGATCACTCGAGTGATCCACCAAAGACTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023881.2-374s1c1
Sequence:CCGGCTAAGACGATCTCCTGCACTACTCGAGTAGTGCAGGAGATCGTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023881.3-312s21c1
Sequence:CCGGCAATGCTCCTTTGAGTCTTTGCTCGAGCAAAGACTCAAAGGAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032579
RETNLB MISSION shRNA Bacterial Glycerol Stock
resistin like beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-184s1c1
Sequence:CCGGCCGTTATGGATAAGAAGATCACTCGAGTGATCTTCTTATCCATAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-197s1c1
Sequence:CCGGGAAGATCAAGGATGTTCTCAACTCGAGTTGAGAACATCCTTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-192s1c1
Sequence:CCGGGATAAGAAGATCAAGGATGTTCTCGAGAACATCCTTGATCTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-579s1c1
Sequence:CCGGGCTTATGTCATCTCTGTTATTCTCGAGAATAACAGAGATGACATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-185s1c1
Sequence:CCGGCGTTATGGATAAGAAGATCAACTCGAGTTGATCTTCTTATCCATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-161s1c1
Sequence:CCGGGAGTACTCAGTGTTCCTTAGACTCGAGTCTAAGGAACACTGAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-532s1c1
Sequence:CCGGCCATTCCTGATTCTTGGGTAACTCGAGTTACCCAAGAATCAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-225s1c1
Sequence:CCGGGAGTACAGTCCCTCTCCTATACTCGAGTATAGGAGAGGGACTGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-168s1c1
Sequence:CCGGCAGTGTTCCTTAGACTCCGTTCTCGAGAACGGAGTCTAAGGAACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032579
RETNLB MISSION shRNA shRNA Plasmid DNA
resistin like beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-184s1c1
Sequence:CCGGCCGTTATGGATAAGAAGATCACTCGAGTGATCTTCTTATCCATAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-197s1c1
Sequence:CCGGGAAGATCAAGGATGTTCTCAACTCGAGTTGAGAACATCCTTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-192s1c1
Sequence:CCGGGATAAGAAGATCAAGGATGTTCTCGAGAACATCCTTGATCTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-579s1c1
Sequence:CCGGGCTTATGTCATCTCTGTTATTCTCGAGAATAACAGAGATGACATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-185s1c1
Sequence:CCGGCGTTATGGATAAGAAGATCAACTCGAGTTGATCTTCTTATCCATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-161s1c1
Sequence:CCGGGAGTACTCAGTGTTCCTTAGACTCGAGTCTAAGGAACACTGAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-532s1c1
Sequence:CCGGCCATTCCTGATTCTTGGGTAACTCGAGTTACCCAAGAATCAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-225s1c1
Sequence:CCGGGAGTACAGTCCCTCTCCTATACTCGAGTATAGGAGAGGGACTGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-168s1c1
Sequence:CCGGCAGTGTTCCTTAGACTCCGTTCTCGAGAACGGAGTCTAAGGAACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032579
RETNLB MISSION shRNA Lentiviral Transduction Particles
resistin like beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-184s1c1
Sequence:CCGGCCGTTATGGATAAGAAGATCACTCGAGTGATCTTCTTATCCATAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-197s1c1
Sequence:CCGGGAAGATCAAGGATGTTCTCAACTCGAGTTGAGAACATCCTTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-192s1c1
Sequence:CCGGGATAAGAAGATCAAGGATGTTCTCGAGAACATCCTTGATCTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-579s1c1
Sequence:CCGGGCTTATGTCATCTCTGTTATTCTCGAGAATAACAGAGATGACATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-185s1c1
Sequence:CCGGCGTTATGGATAAGAAGATCAACTCGAGTTGATCTTCTTATCCATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-161s1c1
Sequence:CCGGGAGTACTCAGTGTTCCTTAGACTCGAGTCTAAGGAACACTGAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032579.1-532s1c1
Sequence:CCGGCCATTCCTGATTCTTGGGTAACTCGAGTTACCCAAGAATCAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-225s1c1
Sequence:CCGGGAGTACAGTCCCTCTCCTATACTCGAGTATAGGAGAGGGACTGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032579.1-168s1c1
Sequence:CCGGCAGTGTTCCTTAGACTCCGTTCTCGAGAACGGAGTCTAAGGAACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)