EMAIL THIS PAGE TO A FRIEND

RETSAT

retinol saturase (all-trans-retinol 13,14-reductase)

44 Gene Product Result for
Gene ID:
Mouse(67442) retinol saturase (all trans retinol 13,14 reductase)
Rat(246298) retinol saturase (all trans retinol 13,14 reductase)
Zebrafish(325922) retinol saturase (all-trans-retinol 13,14-reductase)
dog(483083) retinol saturase (all-trans-retinol 13,14-reductase)
chicken(426549) retinol saturase (all-trans-retinol 13,14-reductase)
domestic cat(101090345) retinol saturase (all-trans-retinol 13,14-reductase)
cow(614455) retinol saturase (all-trans-retinol 13,14-reductase)
sheep(101123106) retinol saturase (all-trans-retinol 13,14-reductase)
domestic guinea pig(100731102) retinol saturase (all-trans-retinol 13,14-reductase)
naked mole-rat(101708622) retinol saturase (all-trans-retinol 13,14-reductase)
Domestic Rabbit(100348884) retinol saturase (all-trans-retinol 13,14-reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017750 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017750 Rosetta Predictions human pricing
NM_145084 Rosetta Predictions rat pricing
NM_026159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083630 predicted 1924
2 SASI_Hs01_00083631 predicted 349
3 SASI_Hs01_00083632 predicted 1917
4 SASI_Hs01_00083634 predicted 232
5 SASI_Hs01_00083635 predicted 528
6 SASI_Hs01_00083636 predicted 1804
7 SASI_Hs02_00350560 predicted 1705
8 SASI_Hs01_00083637 predicted 541
9 SASI_Hs01_00083638 predicted 1803
10 SASI_Hs02_00350561 predicted 1944
11 SASI_Hs01_00083633 predicted 1237
12 SASI_Hs01_00083639 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073896 predicted 1012
2 SASI_Rn01_00073898 predicted 1211
3 SASI_Rn01_00073899 predicted 376
4 SASI_Rn01_00073900 predicted 1395
5 SASI_Rn01_00073901 predicted 1635
6 SASI_Rn01_00073902 predicted 691
7 SASI_Rn01_00073903 predicted 1562
8 SASI_Rn02_00268658 predicted 1260
9 SASI_Rn01_00073905 predicted 888
10 SASI_Rn02_00268659 predicted 705
11 SASI_Rn01_00073897 predicted 1489
12 SASI_Rn01_00073904 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195817 predicted 1481
2 SASI_Mm01_00195818 predicted 1387
3 SASI_Mm01_00195819 predicted 1630
4 SASI_Mm01_00195820 predicted 549
5 SASI_Mm01_00195821 predicted 555
6 SASI_Mm01_00195822 predicted 331
7 SASI_Mm01_00195823 predicted 1480
8 SASI_Mm01_00195824 predicted 1257
9 SASI_Mm01_00195825 predicted 569
10 SASI_Mm01_00195826 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017750
RETSAT MISSION shRNA Bacterial Glycerol Stock
retinol saturase (all-trans-retinol 13,14-reductase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017750.2-1947s1c1
Sequence:CCGGGCACGTATAAAGCACTCTAATCTCGAGATTAGAGTGCTTTATACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-173s1c1
Sequence:CCGGGCCAGGAAGAAGGTTCTCAAACTCGAGTTTGAGAACCTTCTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1793s1c1
Sequence:CCGGCGGAACTTGTACTCAGACCTTCTCGAGAAGGTCTGAGTACAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-113s1c1
Sequence:CCGGCCGAATCCTTTCTCCGAAGATCTCGAGATCTTCGGAGAAAGGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1085s1c1
Sequence:CCGGGCAGGACTGTTCAACACCTATCTCGAGATAGGTGTTGAACAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017750
RETSAT MISSION shRNA shRNA Plasmid DNA
retinol saturase (all-trans-retinol 13,14-reductase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017750.2-1947s1c1
Sequence:CCGGGCACGTATAAAGCACTCTAATCTCGAGATTAGAGTGCTTTATACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-173s1c1
Sequence:CCGGGCCAGGAAGAAGGTTCTCAAACTCGAGTTTGAGAACCTTCTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1793s1c1
Sequence:CCGGCGGAACTTGTACTCAGACCTTCTCGAGAAGGTCTGAGTACAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-113s1c1
Sequence:CCGGCCGAATCCTTTCTCCGAAGATCTCGAGATCTTCGGAGAAAGGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1085s1c1
Sequence:CCGGGCAGGACTGTTCAACACCTATCTCGAGATAGGTGTTGAACAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017750
RETSAT MISSION shRNA Lentiviral Transduction Particles
retinol saturase (all-trans-retinol 13,14-reductase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017750.2-1947s1c1
Sequence:CCGGGCACGTATAAAGCACTCTAATCTCGAGATTAGAGTGCTTTATACGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000064586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-173s1c1
Sequence:CCGGGCCAGGAAGAAGGTTCTCAAACTCGAGTTTGAGAACCTTCTTCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000064587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1793s1c1
Sequence:CCGGCGGAACTTGTACTCAGACCTTCTCGAGAAGGTCTGAGTACAAGTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000064585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-113s1c1
Sequence:CCGGCCGAATCCTTTCTCCGAAGATCTCGAGATCTTCGGAGAAAGGATTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000064584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017750.2-1085s1c1
Sequence:CCGGGCAGGACTGTTCAACACCTATCTCGAGATAGGTGTTGAACAGTCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026159
RETSAT MISSION shRNA Bacterial Glycerol Stock
retinol saturase (all-trans-retinol 13,14-reductase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-335s1c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1044s1c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1057s1c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1633s1c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-145s1c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-335s21c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-145s21c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1633s21c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1057s21c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1044s21c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026159
RETSAT MISSION shRNA shRNA Plasmid DNA
retinol saturase (all-trans-retinol 13,14-reductase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-335s1c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1044s1c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1057s1c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1633s1c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-145s1c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-335s21c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-145s21c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1633s21c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1057s21c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1044s21c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026159
RETSAT MISSION shRNA Lentiviral Transduction Particles
retinol saturase (all-trans-retinol 13,14-reductase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-335s1c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1044s1c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1057s1c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-1633s1c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026159.3-145s1c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-335s21c1
Sequence:CCGGGCCTTGAATTTGACACTGGAACTCGAGTTCCAGTGTCAAATTCAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-145s21c1
Sequence:CCGGGCTAGGAAGAAAGTTCTCAAACTCGAGTTTGAGAACTTTCTTCCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1633s21c1
Sequence:CCGGCCTCATGCAATGGCTTCCATACTCGAGTATGGAAGCCATTGCATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1057s21c1
Sequence:CCGGGCGGGAATGTTCAATACCTATCTCGAGATAGGTATTGAACATTCCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026159.4-1044s21c1
Sequence:CCGGTGTCATCTCCAATGCGGGAATCTCGAGATTCCCGCATTGGAGATGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???