EMAIL THIS PAGE TO A FRIEND

REV3L

REV3-like, polymerase (DNA directed), zeta, catalytic subunit

149 Gene Product Result for
Synonyms: POLZ REV3
UniProtKB ID: O60673, O43214, Q5TC33
Gene ID:
Mouse(19714) REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae)
Rat(309812) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Zebrafish(569100) REV3-like, catalytic subunit of DNA polymerase zeta (yeast)
domestic cat(101087667) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
dog(481963) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
chicken(428622) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
cow(517422) REV3-like, catalytic subunit of DNA polymerase zeta (yeast)
sheep(101110067) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
domestic guinea pig(101787733) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
naked mole-rat(101723274) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Domestic Rabbit(100359215) REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002912 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158271 MISSION® esiRNA esiRNA human REV3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002912 Rosetta Predictions human pricing
NM_001083966 Rosetta Predictions rat pricing
XM_001062779 Rosetta Predictions rat pricing
NM_011264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334725 predicted 6049
2 SASI_Hs01_00062186 predicted 3074
3 SASI_Hs01_00062187 predicted 4496
4 SASI_Hs01_00062189 predicted 9728
5 SASI_Hs01_00062191 predicted 2576
6 SASI_Hs01_00062192 predicted 9762
7 SASI_Hs01_00062193 predicted 5470
8 SASI_Hs02_00334726 predicted 9125
9 SASI_Hs02_00334727 predicted 4601
10 SASI_Hs02_00334728 predicted 3592
11 SASI_Hs01_00062185 predicted 2468
12 SASI_Hs01_00062188 predicted 9623
13 SASI_Hs01_00062190 predicted 846
14 SASI_Hs01_00062194 predicted 10016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208949 predicted 4337
2 SASI_Rn02_00208950 predicted 7866
3 SASI_Rn02_00208951 predicted 572
4 SASI_Rn02_00208952 predicted 7222
5 SASI_Rn02_00208953 predicted 5737
6 SASI_Rn02_00208954 predicted 735
7 SASI_Rn02_00208955 predicted 3958
8 SASI_Rn02_00208956 predicted 8972
9 SASI_Rn02_00208957 predicted 8172
10 SASI_Rn02_00208958 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304543 predicted 4320
2 SASI_Rn02_00304544 predicted 7853
3 SASI_Rn02_00304545 predicted 556
4 SASI_Rn02_00304546 predicted 7207
5 SASI_Rn02_00304547 predicted 5715
6 SASI_Rn02_00304548 predicted 711
7 SASI_Rn02_00304549 predicted 3946
8 SASI_Rn02_00304550 predicted 8954
9 SASI_Rn02_00304551 predicted 8152
10 SASI_Rn02_00304552 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191132 predicted 7192
2 SASI_Mm01_00191133 predicted 8453
3 SASI_Mm02_00320273 predicted 571
4 SASI_Mm01_00191135 predicted 8899
5 SASI_Mm01_00191136 predicted 8788
6 SASI_Mm01_00191137 predicted 4392
7 SASI_Mm01_00191138 predicted 8487
8 SASI_Mm01_00191140 predicted 4417
9 SASI_Mm01_00191141 predicted 4942
10 SASI_Mm02_00320274 predicted 3787
11 SASI_Mm01_00191134 predicted 572
12 SASI_Mm01_00191139 predicted 3855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011264
VALIDATED
REV3L MISSION shRNA Bacterial Glycerol Stock
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-9887s1c1
Sequence:CCGGCCGCATCATTTCACCTTTGAACTCGAGTTCAAAGGTGAAATGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-9236s1c1
Sequence:CCGGGCCACTTACTATATCACCAAACTCGAGTTTGGTGATATAGTAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-2395s1c1
Sequence:CCGGCCGTCACATTAGTGAGACTATCTCGAGATAGTCTCACTAATGTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-7484s1c1
Sequence:CCGGCCTGACATTCTGCTAGGCTATCTCGAGATAGCCTAGCAGAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-6474s1c1
Sequence:CCGGGCCCACATACACTTTCTTCTTCTCGAGAAGAAGAAAGTGTATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-1356s21c1
Sequence:CCGGACCGTGTTCACCAGCTAATATCTCGAGATATTAGCTGGTGAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011264.3-9876s21c1
Sequence:CCGGTGTACAAATTCCGCATCATTTCTCGAGAAATGATGCGGAATTTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-7315s21c1
Sequence:CCGGCTCACGGGTGTAATCGTAATTCTCGAGAATTACGATTACACCCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-4428s21c1
Sequence:CCGGACAGGTATGTTCAGGTATAATCTCGAGATTATACCTGAACATACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-5997s21c1
Sequence:CCGGTGATCTTTCAGAAGCTATATACTCGAGTATATAGCTTCTGAAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011264
VALIDATED
REV3L MISSION shRNA shRNA Plasmid DNA
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-9887s1c1
Sequence:CCGGCCGCATCATTTCACCTTTGAACTCGAGTTCAAAGGTGAAATGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-9236s1c1
Sequence:CCGGGCCACTTACTATATCACCAAACTCGAGTTTGGTGATATAGTAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-2395s1c1
Sequence:CCGGCCGTCACATTAGTGAGACTATCTCGAGATAGTCTCACTAATGTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-7484s1c1
Sequence:CCGGCCTGACATTCTGCTAGGCTATCTCGAGATAGCCTAGCAGAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-6474s1c1
Sequence:CCGGGCCCACATACACTTTCTTCTTCTCGAGAAGAAGAAAGTGTATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-1356s21c1
Sequence:CCGGACCGTGTTCACCAGCTAATATCTCGAGATATTAGCTGGTGAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011264.3-9876s21c1
Sequence:CCGGTGTACAAATTCCGCATCATTTCTCGAGAAATGATGCGGAATTTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-7315s21c1
Sequence:CCGGCTCACGGGTGTAATCGTAATTCTCGAGAATTACGATTACACCCGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-4428s21c1
Sequence:CCGGACAGGTATGTTCAGGTATAATCTCGAGATTATACCTGAACATACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-5997s21c1
Sequence:CCGGTGATCTTTCAGAAGCTATATACTCGAGTATATAGCTTCTGAAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011264
VALIDATED
REV3L MISSION shRNA Lentiviral Transduction Particles
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-9887s1c1
Sequence:CCGGCCGCATCATTTCACCTTTGAACTCGAGTTCAAAGGTGAAATGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-9236s1c1
Sequence:CCGGGCCACTTACTATATCACCAAACTCGAGTTTGGTGATATAGTAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-2395s1c1
Sequence:CCGGCCGTCACATTAGTGAGACTATCTCGAGATAGTCTCACTAATGTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011264.1-7484s1c1
Sequence:CCGGCCTGACATTCTGCTAGGCTATCTCGAGATAGCCTAGCAGAATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011264.1-6474s1c1
Sequence:CCGGGCCCACATACACTTTCTTCTTCTCGAGAAGAAGAAAGTGTATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-1356s21c1
Sequence:CCGGACCGTGTTCACCAGCTAATATCTCGAGATATTAGCTGGTGAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011264.3-9876s21c1
Sequence:CCGGTGTACAAATTCCGCATCATTTCTCGAGAAATGATGCGGAATTTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-7315s21c1
Sequence:CCGGCTCACGGGTGTAATCGTAATTCTCGAGAATTACGATTACACCCGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-4428s21c1
Sequence:CCGGACAGGTATGTTCAGGTATAATCTCGAGATTATACCTGAACATACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011264.3-5997s21c1
Sequence:CCGGTGATCTTTCAGAAGCTATATACTCGAGTATATAGCTTCTGAAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002912
VALIDATED
REV3L MISSION shRNA Bacterial Glycerol Stock
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-8872s1c1
Sequence:CCGGCGAGCTATTAAACTGGTGAATCTCGAGATTCACCAGTTTAATAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-1014s1c1
Sequence:CCGGCGGAGCCATAATGAATAAATTCTCGAGAATTTATTCATTATGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-9201s1c1
Sequence:CCGGGCGTTCTCTAAAGCTGCTATTCTCGAGAATAGCAGCTTTAGAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-6400s1c1
Sequence:CCGGGCTGAGTTTGAGGGAGACTTTCTCGAGAAAGTCTCCCTCAAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6861s21c1
Sequence:CCGGCTAGTGATATCTCCAATTAATCTCGAGATTAATTGGAGATATCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-9845s21c1
Sequence:CCGGCTTCTATGCTAACCGAATTAACTCGAGTTAATTCGGTTAGCATAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6014s21c1
Sequence:CCGGTGACCTGTCTGAGACTATTTACTCGAGTAAATAGTCTCAGACAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-8034s21c1
Sequence:CCGGGCTAAACCAATGAACTATATTCTCGAGAATATAGTTCATTGGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002912.3-2614s21c1
Sequence:CCGGCTGATGAAAGTGGACTAAATACTCGAGTATTTAGTCCACTTTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002912
VALIDATED
REV3L MISSION shRNA shRNA Plasmid DNA
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-8872s1c1
Sequence:CCGGCGAGCTATTAAACTGGTGAATCTCGAGATTCACCAGTTTAATAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-1014s1c1
Sequence:CCGGCGGAGCCATAATGAATAAATTCTCGAGAATTTATTCATTATGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-9201s1c1
Sequence:CCGGGCGTTCTCTAAAGCTGCTATTCTCGAGAATAGCAGCTTTAGAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-6400s1c1
Sequence:CCGGGCTGAGTTTGAGGGAGACTTTCTCGAGAAAGTCTCCCTCAAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6861s21c1
Sequence:CCGGCTAGTGATATCTCCAATTAATCTCGAGATTAATTGGAGATATCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-9845s21c1
Sequence:CCGGCTTCTATGCTAACCGAATTAACTCGAGTTAATTCGGTTAGCATAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6014s21c1
Sequence:CCGGTGACCTGTCTGAGACTATTTACTCGAGTAAATAGTCTCAGACAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-8034s21c1
Sequence:CCGGGCTAAACCAATGAACTATATTCTCGAGAATATAGTTCATTGGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002912.3-2614s21c1
Sequence:CCGGCTGATGAAAGTGGACTAAATACTCGAGTATTTAGTCCACTTTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002912
VALIDATED
REV3L MISSION shRNA Lentiviral Transduction Particles
REV3-like, polymerase (DNA directed), zeta, catalytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-8872s1c1
Sequence:CCGGCGAGCTATTAAACTGGTGAATCTCGAGATTCACCAGTTTAATAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-1014s1c1
Sequence:CCGGCGGAGCCATAATGAATAAATTCTCGAGAATTTATTCATTATGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-9201s1c1
Sequence:CCGGGCGTTCTCTAAAGCTGCTATTCTCGAGAATAGCAGCTTTAGAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002912.1-6400s1c1
Sequence:CCGGGCTGAGTTTGAGGGAGACTTTCTCGAGAAAGTCTCCCTCAAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6861s21c1
Sequence:CCGGCTAGTGATATCTCCAATTAATCTCGAGATTAATTGGAGATATCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-9845s21c1
Sequence:CCGGCTTCTATGCTAACCGAATTAACTCGAGTTAATTCGGTTAGCATAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-6014s21c1
Sequence:CCGGTGACCTGTCTGAGACTATTTACTCGAGTAAATAGTCTCAGACAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002912.3-8034s21c1
Sequence:CCGGGCTAAACCAATGAACTATATTCTCGAGAATATAGTTCATTGGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002912.3-2614s21c1
Sequence:CCGGCTGATGAAAGTGGACTAAATACTCGAGTATTTAGTCCACTTTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)