EMAIL THIS PAGE TO A FRIEND

REXO1L5P

REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 5, pseudogene

14 Gene Product Result for
Species: Human REXO1L5P(441361)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496983 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496983 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280102 predicted 643
2 SASI_Hs01_00280103 predicted 1471
3 SASI_Hs01_00280106 predicted 904
4 SASI_Hs02_00480070 predicted 643
5 SASI_Hs02_00480071 predicted 637
6 SASI_Hs01_00280108 predicted 300
7 SASI_Hs02_00480072 predicted 1470
8 SASI_Hs01_00280109 predicted 1503
9 SASI_Hs02_00480073 predicted 1021
10 SASI_Hs01_00280111 predicted 575
11 SASI_Hs01_00280104 predicted 2337
12 SASI_Hs01_00280105 predicted 2372
13 SASI_Hs01_00280107 predicted 2045
14 SASI_Hs01_00280110 predicted 2410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496983
REXO1L5P MISSION shRNA Bacterial Glycerol Stock
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 5, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1664s21c1
Sequence:CCGGACGTCGCTAAGACGAGCATCACTCGAGTGATGCTCGTCTTAGCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-36s21c1
Sequence:CCGGTGGATACCCAGAAGCTAAGAACTCGAGTTCTTAGCTTCTGGGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1869s21c1
Sequence:CCGGCGACTACCTGGCACAGATCATCTCGAGATGATCTGTGCCAGGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-913s21c1
Sequence:CCGGACCGAAGAGTGTCTCAAGTTCCTCGAGGAACTTGAGACACTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1452s21c1
Sequence:CCGGCTTCGTGGAGACCTTCAAGAACTCGAGTTCTTGAAGGTCTCCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496983
REXO1L5P MISSION shRNA shRNA Plasmid DNA
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 5, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1664s21c1
Sequence:CCGGACGTCGCTAAGACGAGCATCACTCGAGTGATGCTCGTCTTAGCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-36s21c1
Sequence:CCGGTGGATACCCAGAAGCTAAGAACTCGAGTTCTTAGCTTCTGGGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1869s21c1
Sequence:CCGGCGACTACCTGGCACAGATCATCTCGAGATGATCTGTGCCAGGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-913s21c1
Sequence:CCGGACCGAAGAGTGTCTCAAGTTCCTCGAGGAACTTGAGACACTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1452s21c1
Sequence:CCGGCTTCGTGGAGACCTTCAAGAACTCGAGTTCTTGAAGGTCTCCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496983
REXO1L5P MISSION shRNA Lentiviral Transduction Particles
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 5, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1664s21c1
Sequence:CCGGACGTCGCTAAGACGAGCATCACTCGAGTGATGCTCGTCTTAGCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-36s21c1
Sequence:CCGGTGGATACCCAGAAGCTAAGAACTCGAGTTCTTAGCTTCTGGGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1869s21c1
Sequence:CCGGCGACTACCTGGCACAGATCATCTCGAGATGATCTGTGCCAGGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-913s21c1
Sequence:CCGGACCGAAGAGTGTCTCAAGTTCCTCGAGGAACTTGAGACACTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_496983.3-1452s21c1
Sequence:CCGGCTTCGTGGAGACCTTCAAGAACTCGAGTTCTTGAAGGTCTCCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)