EMAIL THIS PAGE TO A FRIEND

REXO2

RNA exonuclease 2

95 Gene Product Result for
Synonyms: REX2 RFN SFN
UniProtKB ID: Q9Y3B8, Q32Q18, Q53FT1, Q6FIC6, Q9UFY7
Gene ID:
Human(25996) Summary: This gene encodes a 3'-to-5' exonuclease specific for small (primarily 5 nucleotides or less in length) single-stranded RNA and DNA oligomers. This protein may have a role in DNA repair, replication, and recombination, and in RNA processing and degradation. It may also be involved in resistance of human cells to UV-C-induced cell death through its role in the DNA repair process. [provided by RefSeq, Nov 2011]
Mouse(104444) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
Rat(300689) RNA exonuclease 2
chicken(419761) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
dog(489395) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
domestic cat(101083700) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
naked mole-rat(101718042) RNA exonuclease 2
domestic guinea pig(100731479) RNA exonuclease 2
cow(540139) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
sheep(101111575) REX2, RNA exonuclease 2 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0069 AQUA Peptide ALDDISESI[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015523 Rosetta Predictions human pricing
NM_001008326 Rosetta Predictions rat pricing
NM_024233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191874 predicted 256
2 SASI_Hs01_00191875 predicted 398
3 SASI_Hs01_00191879 predicted 241
4 SASI_Hs02_00348017 predicted 427
5 SASI_Hs01_00191882 predicted 275
6 SASI_Hs01_00191883 predicted 393
7 SASI_Hs02_00348018 predicted 376
8 SASI_Hs02_00348019 predicted 261
9 SASI_Hs02_00348020 predicted 380
10 SASI_Hs02_00348021 predicted 346
11 SASI_Hs01_00191876 predicted 225
12 SASI_Hs01_00191877 predicted 502
13 SASI_Hs01_00191878 predicted 609
14 SASI_Hs01_00191880 predicted 488
15 SASI_Hs01_00191881 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112901 predicted 324
2 SASI_Rn01_00112902 predicted 329
3 SASI_Rn01_00112903 predicted 679
4 SASI_Rn01_00112905 predicted 326
5 SASI_Rn01_00112906 predicted 455
6 SASI_Rn02_00199067 predicted 567
7 SASI_Rn01_00112908 predicted 351
8 SASI_Rn01_00112909 predicted 347
9 SASI_Rn01_00112910 predicted 686
10 SASI_Rn02_00199068 predicted 472
11 SASI_Rn01_00112904 predicted 264
12 SASI_Rn01_00112907 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028264 predicted 635
2 SASI_Mm02_00327602 predicted 591
3 SASI_Mm01_00028265 predicted 233
4 SASI_Mm01_00028266 predicted 491
5 SASI_Mm01_00028267 predicted 361
6 SASI_Mm01_00028270 predicted 338
7 SASI_Mm02_00327603 predicted 416
8 SASI_Mm01_00028273 predicted 551
9 SASI_Mm02_00327604 predicted 208
10 SASI_Mm02_00327605 predicted 201
11 SASI_Mm01_00028268 predicted 207
12 SASI_Mm01_00028269 predicted 327
13 SASI_Mm01_00028271 predicted 261
14 SASI_Mm01_00028272 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015523
VALIDATED
REXO2 MISSION shRNA Bacterial Glycerol Stock
RNA exonuclease 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-346s21c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-468s21c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-561s21c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-729s21c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-663s1c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-495s1c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-280s1c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-402s1c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-707s1c1
Sequence:CCGGCCGAAATAACATCTTCAAGAACTCGAGTTCTTGAAGATGTTATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015523
VALIDATED
REXO2 MISSION shRNA shRNA Plasmid DNA
RNA exonuclease 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-346s21c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-468s21c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-561s21c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-729s21c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-663s1c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-495s1c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-280s1c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-402s1c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-707s1c1
Sequence:CCGGCCGAAATAACATCTTCAAGAACTCGAGTTCTTGAAGATGTTATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015523
VALIDATED
REXO2 MISSION shRNA Lentiviral Transduction Particles
RNA exonuclease 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-346s21c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-468s21c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-561s21c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015523.3-729s21c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-663s1c1
Sequence:CCGGGCACTTGATGACATTAGTGAACTCGAGTTCACTAATGTCATCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-495s1c1
Sequence:CCGGGCAGGAAATTCAGTTCATGAACTCGAGTTCATGAACTGAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-280s1c1
Sequence:CCGGCTGACTCTGATCTCAACATTTCTCGAGAAATGTTGAGATCAGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-402s1c1
Sequence:CCGGGCAGTGAAGGAGAGTACAATTCTCGAGAATTGTACTCTCCTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015523.1-707s1c1
Sequence:CCGGCCGAAATAACATCTTCAAGAACTCGAGTTCTTGAAGATGTTATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024233
VALIDATED
REXO2 MISSION shRNA Bacterial Glycerol Stock
RNA exonuclease 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-218s21c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-645s21c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-254s21c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024233.3-913s21c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-915s1c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-646s1c1
Sequence:CCGGGCACTGGATGACATTAGTGAACTCGAGTTCACTAATGTCATCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-220s1c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-647s1c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-256s1c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024233
VALIDATED
REXO2 MISSION shRNA shRNA Plasmid DNA
RNA exonuclease 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-218s21c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-645s21c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-254s21c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024233.3-913s21c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-915s1c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-646s1c1
Sequence:CCGGGCACTGGATGACATTAGTGAACTCGAGTTCACTAATGTCATCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-220s1c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-647s1c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-256s1c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024233
VALIDATED
REXO2 MISSION shRNA Lentiviral Transduction Particles
RNA exonuclease 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-218s21c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-645s21c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024233.3-254s21c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024233.3-913s21c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-915s1c1
Sequence:CCGGGCAGACATCACTCTTCCGTTTCTCGAGAAACGGAAGAGTGATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-646s1c1
Sequence:CCGGGCACTGGATGACATTAGTGAACTCGAGTTCACTAATGTCATCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-220s1c1
Sequence:CCGGGATATTGAGAAGGATCAGATTCTCGAGAATCTGATCCTTCTCAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-647s1c1
Sequence:CCGGCACTGGATGACATTAGTGAAACTCGAGTTTCACTAATGTCATCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024233.2-256s1c1
Sequence:CCGGCTGATAACTGACTCTGATCTTCTCGAGAAGATCAGAGTCAGTTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)