EMAIL THIS PAGE TO A FRIEND

RFC1

replication factor C (activator 1) 1, 145kDa

56 Gene Product Result for
Synonyms: A1 MHCBFB PO-GA RECC1 RFC RFC140
UniProtKB ID: P35251, A8K6E7, Q5XKF5, Q6PKU0, Q86V41, Q86V46
Gene ID:
Human(5981) Summary: This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Mouse(19687) replication factor C (activator 1) 1
Rat(89809) replication factor C (activator 1) 1
Thale Cress(832261) replication factor C1
Horse(100064382) replication factor C (activator 1) 1, 145kDa
domestic cat(101094345) replication factor C (activator 1) 1, 145kDa
dog(479112) replication factor C (activator 1) 1, 145kDa
chicken(422788) replication factor C (activator 1) 1, 145kDa
Zebrafish(100037336) replication factor C (activator 1) 1
domestic guinea pig(100733981) replication factor C (activator 1) 1, 145kDa
naked mole-rat(101697246) replication factor C (activator 1) 1, 145kDa
cow(514842) replication factor C (activator 1) 1, 145kDa
sheep(101109450) replication factor C (activator 1) 1, 145kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002913 Rosetta Predictions human pricing
NM_053547 Rosetta Predictions rat pricing
NM_011258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159433 predicted 2331
2 SASI_Hs01_00159435 predicted 1252
3 SASI_Hs02_00334729 predicted 3193
4 SASI_Hs01_00159436 predicted 2601
5 SASI_Hs01_00159437 predicted 260
6 SASI_Hs01_00159438 predicted 2462
7 SASI_Hs01_00159439 predicted 2176
8 SASI_Hs01_00159440 predicted 2547
9 SASI_Hs01_00159441 predicted 3156
10 SASI_Hs01_00159442 predicted 2667
11 SASI_Hs01_00159434 predicted 3203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266179 predicted 890
2 SASI_Rn02_00266180 predicted 2231
3 SASI_Rn02_00266181 predicted 2494
4 SASI_Rn02_00266182 predicted 2082
5 SASI_Rn02_00266183 predicted 2542
6 SASI_Rn02_00266184 predicted 3014
7 SASI_Rn02_00266185 predicted 2927
8 SASI_Rn02_00266186 predicted 3000
9 SASI_Rn02_00266187 predicted 2837
10 SASI_Rn02_00266188 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135623 predicted 1379
2 SASI_Mm01_00135624 predicted 1239
3 SASI_Mm01_00135625 predicted 1228
4 SASI_Mm01_00135626 predicted 910
5 SASI_Mm01_00135627 predicted 2993
6 SASI_Mm01_00135628 predicted 2111
7 SASI_Mm02_00320263 predicted 2269
8 SASI_Mm01_00135629 predicted 2876
9 SASI_Mm01_00135630 predicted 2078
10 SASI_Mm01_00135631 predicted 2676
11 SASI_Mm01_00135632 predicted 2390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002913
VALIDATED
RFC1 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 1, 145kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1349s21c1
Sequence:CCGGTTGCTTGGAAGGCCTTATATTCTCGAGAATATAAGGCCTTCCAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1911s21c1
Sequence:CCGGACCTCGCTCAAGACCATAATTCTCGAGAATTATGGTCTTGAGCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-2589s21c1
Sequence:CCGGATGTGGTGTGCACGAAGTAAACTCGAGTTTACTTCGTGCACACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-889s21c1
Sequence:CCGGCATCTGTCCAAGCCAATTTAACTCGAGTTAAATTGGCTTGGACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3733s21c1
Sequence:CCGGGGGTATGAGCAGTAGGCTTATCTCGAGATAAGCCTACTGCTCATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3353s21c1
Sequence:CCGGATACTCACTTCAAGCTATAAACTCGAGTTTATAGCTTGAAGTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-2171s1c1
Sequence:CCGGCCGGAGTAAGAGCAGTTTGAACTCGAGTTCAAACTGCTCTTACTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-1260s1c1
Sequence:CCGGCGCACTAATTATCAAGCTTATCTCGAGATAAGCTTGATAATTAGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-441s1c1
Sequence:CCGGCCTGTTACATACATTTCAGAACTCGAGTTCTGAAATGTATGTAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002913.3-2520s1c1
Sequence:CCGGCCTCCAGCTATGAATGAAATACTCGAGTATTTCATTCATAGCTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-744s1c1
Sequence:CCGGGCCAAGCAATTACAGCTTGATCTCGAGATCAAGCTGTAATTGCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002913
VALIDATED
RFC1 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 1, 145kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1349s21c1
Sequence:CCGGTTGCTTGGAAGGCCTTATATTCTCGAGAATATAAGGCCTTCCAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1911s21c1
Sequence:CCGGACCTCGCTCAAGACCATAATTCTCGAGAATTATGGTCTTGAGCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-2589s21c1
Sequence:CCGGATGTGGTGTGCACGAAGTAAACTCGAGTTTACTTCGTGCACACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-889s21c1
Sequence:CCGGCATCTGTCCAAGCCAATTTAACTCGAGTTAAATTGGCTTGGACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3733s21c1
Sequence:CCGGGGGTATGAGCAGTAGGCTTATCTCGAGATAAGCCTACTGCTCATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3353s21c1
Sequence:CCGGATACTCACTTCAAGCTATAAACTCGAGTTTATAGCTTGAAGTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-2171s1c1
Sequence:CCGGCCGGAGTAAGAGCAGTTTGAACTCGAGTTCAAACTGCTCTTACTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-1260s1c1
Sequence:CCGGCGCACTAATTATCAAGCTTATCTCGAGATAAGCTTGATAATTAGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-441s1c1
Sequence:CCGGCCTGTTACATACATTTCAGAACTCGAGTTCTGAAATGTATGTAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002913.3-2520s1c1
Sequence:CCGGCCTCCAGCTATGAATGAAATACTCGAGTATTTCATTCATAGCTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-744s1c1
Sequence:CCGGGCCAAGCAATTACAGCTTGATCTCGAGATCAAGCTGTAATTGCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002913
VALIDATED
RFC1 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 1, 145kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1349s21c1
Sequence:CCGGTTGCTTGGAAGGCCTTATATTCTCGAGAATATAAGGCCTTCCAAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-1911s21c1
Sequence:CCGGACCTCGCTCAAGACCATAATTCTCGAGAATTATGGTCTTGAGCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-2589s21c1
Sequence:CCGGATGTGGTGTGCACGAAGTAAACTCGAGTTTACTTCGTGCACACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-889s21c1
Sequence:CCGGCATCTGTCCAAGCCAATTTAACTCGAGTTAAATTGGCTTGGACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3733s21c1
Sequence:CCGGGGGTATGAGCAGTAGGCTTATCTCGAGATAAGCCTACTGCTCATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002913.3-3353s21c1
Sequence:CCGGATACTCACTTCAAGCTATAAACTCGAGTTTATAGCTTGAAGTGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-2171s1c1
Sequence:CCGGCCGGAGTAAGAGCAGTTTGAACTCGAGTTCAAACTGCTCTTACTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-1260s1c1
Sequence:CCGGCGCACTAATTATCAAGCTTATCTCGAGATAAGCTTGATAATTAGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002913.3-441s1c1
Sequence:CCGGCCTGTTACATACATTTCAGAACTCGAGTTCTGAAATGTATGTAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002913.3-2520s1c1
Sequence:CCGGCCTCCAGCTATGAATGAAATACTCGAGTATTTCATTCATAGCTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002913.3-744s1c1
Sequence:CCGGGCCAAGCAATTACAGCTTGATCTCGAGATCAAGCTGTAATTGCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011258
VALIDATED
RFC1 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 1, 145kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-3951s1c1
Sequence:CCGGCCGAGTATTCTTGGTGTATTACTCGAGTAATACACCAAGAATACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-1195s1c1
Sequence:CCGGGCGCACTAATTATCAAGCTTACTCGAGTAAGCTTGATAATTAGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-876s1c1
Sequence:CCGGGCCCTAATAAAGCCGAGCTTTCTCGAGAAAGCTCGGCTTTATTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-2072s1c1
Sequence:CCGGCGGAGTAAGAACAGTTTGAAACTCGAGTTTCAAACTGTTCTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-133s1c1
Sequence:CCGGCGAGACAGTAAAGAATGAGAACTCGAGTTCTCATTCTTTACTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011258
VALIDATED
RFC1 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 1, 145kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-3951s1c1
Sequence:CCGGCCGAGTATTCTTGGTGTATTACTCGAGTAATACACCAAGAATACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-1195s1c1
Sequence:CCGGGCGCACTAATTATCAAGCTTACTCGAGTAAGCTTGATAATTAGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-876s1c1
Sequence:CCGGGCCCTAATAAAGCCGAGCTTTCTCGAGAAAGCTCGGCTTTATTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-2072s1c1
Sequence:CCGGCGGAGTAAGAACAGTTTGAAACTCGAGTTTCAAACTGTTCTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-133s1c1
Sequence:CCGGCGAGACAGTAAAGAATGAGAACTCGAGTTCTCATTCTTTACTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011258
VALIDATED
RFC1 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 1, 145kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-3951s1c1
Sequence:CCGGCCGAGTATTCTTGGTGTATTACTCGAGTAATACACCAAGAATACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-1195s1c1
Sequence:CCGGGCGCACTAATTATCAAGCTTACTCGAGTAAGCTTGATAATTAGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-876s1c1
Sequence:CCGGGCCCTAATAAAGCCGAGCTTTCTCGAGAAAGCTCGGCTTTATTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-2072s1c1
Sequence:CCGGCGGAGTAAGAACAGTTTGAAACTCGAGTTTCAAACTGTTCTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011258.1-133s1c1
Sequence:CCGGCGAGACAGTAAAGAATGAGAACTCGAGTTCTCATTCTTTACTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)