EMAIL THIS PAGE TO A FRIEND

RFC3

replication factor C (activator 1) 3, 38kDa

132 Gene Product Result for
Synonyms: RFC38
UniProtKB ID: P40938, C9JU95, O15252, Q5W0E8
Gene ID:
Human(5983) Summary: The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(69263) replication factor C (activator 1) 3
Rat(288414) replication factor C (activator 1) 3
fruit fly(34423) Replication factor C subunit 3
Zebrafish(259256) replication factor C (activator 1) 3
chicken(418907) replication factor C (activator 1) 3, 38kDa
Horse(100062326) replication factor C (activator 1) 3, 38kDa
domestic cat(101081597) replication factor C (activator 1) 3, 38kDa
dog(477308) replication factor C (activator 1) 3, 38kDa
Thale Cress(844083) replication factor C subunit 3
Thale Cress(820974) translation elongation factor EF1B/ribosomal protein S6 family protein
domestic guinea pig(100714795) replication factor C (activator 1) 3, 38kDa
naked mole-rat(101723031) replication factor C (activator 1) 3, 38kDa
Domestic Rabbit(100339186) replication factor C (activator 1) 3, 38kDa
cow(515602) replication factor C (activator 1) 3, 38kDa
sheep(101108399) replication factor C (activator 1) 3, 38kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100565 Anti-RFC3 (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW21946F Anti-RFC3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1406383 Anti-RFC3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV46085 Anti-RFC3 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, mouse, canine, human, rat, rabbit, horse
western blot pricing
SAB2101987 Anti-RFC3 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, bovine, horse, zebrafish, rat, canine, human, rabbit,
western blot pricing
HPA030149 Anti-RFC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0005983M1 Monoclonal Anti-RFC3 antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1404313 Monoclonal Anti-RFC3 antibody produced in mouse clone 1B6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
PLA0059 Rabbit anti-RFC3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. marmoset, horse, chimpanzee, bovine, rat, human, rhesus monkey, dog, pig, primate, gorilla
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002915 Rosetta Predictions human pricing
NM_181558 Rosetta Predictions human pricing
NM_001009629 Rosetta Predictions rat pricing
NM_027009 Rosetta Predictions mouse pricing
XM_906911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334730 predicted 684
2 SASI_Hs02_00334731 predicted 615
3 SASI_Hs02_00334732 predicted 684
4 SASI_Hs02_00334733 predicted 598
5 SASI_Hs02_00334734 predicted 623
6 SASI_Hs02_00334735 predicted 712
7 SASI_Hs02_00334736 predicted 752
8 SASI_Hs02_00334737 predicted 598
9 SASI_Hs02_00334738 predicted 680
10 SASI_Hs02_00334739 predicted 624
11 SASI_Hs01_00216843 predicted 865
12 SASI_Hs01_00216844 predicted 350
13 SASI_Hs01_00216845 predicted 1135
14 SASI_Hs01_00216846 predicted 1095
15 SASI_Hs01_00216847 predicted 824
16 SASI_Hs01_00216848 predicted 1155
17 SASI_Hs01_00216849 predicted 758
18 SASI_Hs01_00216850 predicted 887
19 SASI_Hs01_00216851 predicted 433
20 SASI_Hs01_00216852 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370170 predicted 689
2 SASI_Hs02_00370171 predicted 617
3 SASI_Hs02_00370172 predicted 691
4 SASI_Hs02_00370173 predicted 599
5 SASI_Hs02_00370174 predicted 622
6 SASI_Hs02_00370175 predicted 704
7 SASI_Hs02_00370176 predicted 752
8 SASI_Hs01_00207989 predicted 596
9 SASI_Hs02_00370177 predicted 673
10 SASI_Hs02_00370178 predicted 618
11 SASI_Hs01_00207983 predicted 343
12 SASI_Hs01_00207984 predicted 648
13 SASI_Hs01_00207985 predicted 666
14 SASI_Hs01_00207986 predicted 727
15 SASI_Hs01_00207987 predicted 428
16 SASI_Hs01_00207988 predicted 440
17 SASI_Hs01_00207990 predicted 692
18 SASI_Hs01_00207991 predicted 286
19 SASI_Hs01_00207992 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093283 predicted 305
2 SASI_Rn01_00093284 predicted 276
3 SASI_Rn01_00093285 predicted 400
4 SASI_Rn01_00093286 predicted 548
5 SASI_Rn01_00093287 predicted 766
6 SASI_Rn01_00093288 predicted 208
7 SASI_Rn01_00093289 predicted 909
8 SASI_Rn01_00093290 predicted 254
9 SASI_Rn01_00093291 predicted 218
10 SASI_Rn01_00093292 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331383 predicted 799
2 SASI_Mm02_00331384 predicted 822
3 SASI_Mm02_00331385 predicted 877
4 SASI_Mm02_00331386 predicted 794
5 SASI_Mm02_00331387 predicted 523
6 SASI_Mm02_00331388 predicted 722
7 SASI_Mm02_00331389 predicted 881
8 SASI_Mm02_00331390 predicted 708
9 SASI_Mm02_00331391 predicted 885
10 SASI_Mm02_00331392 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254044 predicted 979
2 SASI_Mm01_00254045 predicted 1233
3 SASI_Mm01_00254046 predicted 1119
4 SASI_Mm01_00254047 predicted 1009
5 SASI_Mm01_00254048 predicted 1209
6 SASI_Mm01_00254049 predicted 1189
7 SASI_Mm01_00254050 predicted 1073
8 SASI_Mm01_00254051 predicted 1197
9 SASI_Mm01_00254052 predicted 702
10 SASI_Mm01_00254053 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027009
RFC3 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 3, 38kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-991s21c1
Sequence:CCGGCACAGATGGCAGCCTACTATGCTCGAGCATAGTAGGCTGCCATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-323s21c1
Sequence:GTACCGGCAACTACCACCTTGAAGTTAACTCGAGTTAACTTCAAGGTGGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-911s21c1
Sequence:CCGGTATTCCTCCTGAGATTATAATCTCGAGATTATAATCTCAGGAGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-611s21c1
Sequence:CCGGTGCTCCCAGCATCGAAGATATCTCGAGATATCTTCGATGCTGGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-436s21c1
Sequence:CCGGGAGACTTCAAAGTGGTATTATCTCGAGATAATACCACTTTGAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-160s21c1
Sequence:CCGGTTCCTCACCTCTTAGTATATGCTCGAGCATATACTAAGAGGTGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-159s21c1
Sequence:CCGGTTTCCTCACCTCTTAGTATATCTCGAGATATACTAAGAGGTGAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027009
RFC3 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 3, 38kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-991s21c1
Sequence:CCGGCACAGATGGCAGCCTACTATGCTCGAGCATAGTAGGCTGCCATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-323s21c1
Sequence:GTACCGGCAACTACCACCTTGAAGTTAACTCGAGTTAACTTCAAGGTGGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-911s21c1
Sequence:CCGGTATTCCTCCTGAGATTATAATCTCGAGATTATAATCTCAGGAGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-611s21c1
Sequence:CCGGTGCTCCCAGCATCGAAGATATCTCGAGATATCTTCGATGCTGGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-436s21c1
Sequence:CCGGGAGACTTCAAAGTGGTATTATCTCGAGATAATACCACTTTGAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-160s21c1
Sequence:CCGGTTCCTCACCTCTTAGTATATGCTCGAGCATATACTAAGAGGTGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-159s21c1
Sequence:CCGGTTTCCTCACCTCTTAGTATATCTCGAGATATACTAAGAGGTGAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027009
RFC3 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 3, 38kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-991s21c1
Sequence:CCGGCACAGATGGCAGCCTACTATGCTCGAGCATAGTAGGCTGCCATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-323s21c1
Sequence:GTACCGGCAACTACCACCTTGAAGTTAACTCGAGTTAACTTCAAGGTGGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-911s21c1
Sequence:CCGGTATTCCTCCTGAGATTATAATCTCGAGATTATAATCTCAGGAGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-611s21c1
Sequence:CCGGTGCTCCCAGCATCGAAGATATCTCGAGATATCTTCGATGCTGGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-436s21c1
Sequence:CCGGGAGACTTCAAAGTGGTATTATCTCGAGATAATACCACTTTGAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-160s21c1
Sequence:CCGGTTCCTCACCTCTTAGTATATGCTCGAGCATATACTAAGAGGTGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027009.2-159s21c1
Sequence:CCGGTTTCCTCACCTCTTAGTATATCTCGAGATATACTAAGAGGTGAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181558
VALIDATED
RFC3 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 3, 38kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181558.2-1205s21c1
Sequence:CCGGGGTTAGGTCCACCTGCTAATCCTCGAGGATTAGCAGGTGGACCTAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-360s21c1
Sequence:CCGGATTAGCACCATTGCAAGTAACCTCGAGGTTACTTGCAATGGTGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-415s21c1
Sequence:CCGGATAGTGACCGAGTAGTCATTCCTCGAGGAATGACTACTCGGTCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-680s21c1
Sequence:CCGGAGATATTTGCCACGTGTTATCCTCGAGGATAACACGTGGCAAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-803s21c1
Sequence:CCGGAGCCTGCAGAGTGCAACAATACTCGAGTATTGTTGCACTCTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181558.1-1156s1c1
Sequence:CCGGCCTGCTAATCACATCCACAAACTCGAGTTTGTGGATGTGATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-571s1c1
Sequence:CCGGGTGCTGCAATTCTACATCTAACTCGAGTTAGATGTAGAATTGCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-639s1c1
Sequence:CCGGCTCCCAGCATTGAAGATGGAACTCGAGTTCCATCTTCAATGCTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_181558.1-380s1c1
Sequence:CCGGGCTGGAAATAGTGACCGAGTACTCGAGTACTCGGTCACTATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-344s1c1
Sequence:CCGGGCAAGTAACTACCACCTTGAACTCGAGTTCAAGGTGGTAGTTACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181558
VALIDATED
RFC3 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 3, 38kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181558.2-1205s21c1
Sequence:CCGGGGTTAGGTCCACCTGCTAATCCTCGAGGATTAGCAGGTGGACCTAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-360s21c1
Sequence:CCGGATTAGCACCATTGCAAGTAACCTCGAGGTTACTTGCAATGGTGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-415s21c1
Sequence:CCGGATAGTGACCGAGTAGTCATTCCTCGAGGAATGACTACTCGGTCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-680s21c1
Sequence:CCGGAGATATTTGCCACGTGTTATCCTCGAGGATAACACGTGGCAAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-803s21c1
Sequence:CCGGAGCCTGCAGAGTGCAACAATACTCGAGTATTGTTGCACTCTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181558.1-1156s1c1
Sequence:CCGGCCTGCTAATCACATCCACAAACTCGAGTTTGTGGATGTGATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-571s1c1
Sequence:CCGGGTGCTGCAATTCTACATCTAACTCGAGTTAGATGTAGAATTGCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-639s1c1
Sequence:CCGGCTCCCAGCATTGAAGATGGAACTCGAGTTCCATCTTCAATGCTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_181558.1-380s1c1
Sequence:CCGGGCTGGAAATAGTGACCGAGTACTCGAGTACTCGGTCACTATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-344s1c1
Sequence:CCGGGCAAGTAACTACCACCTTGAACTCGAGTTCAAGGTGGTAGTTACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181558
VALIDATED
RFC3 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 3, 38kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181558.2-1205s21c1
Sequence:CCGGGGTTAGGTCCACCTGCTAATCCTCGAGGATTAGCAGGTGGACCTAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-360s21c1
Sequence:CCGGATTAGCACCATTGCAAGTAACCTCGAGGTTACTTGCAATGGTGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-415s21c1
Sequence:CCGGATAGTGACCGAGTAGTCATTCCTCGAGGAATGACTACTCGGTCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-680s21c1
Sequence:CCGGAGATATTTGCCACGTGTTATCCTCGAGGATAACACGTGGCAAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181558.2-803s21c1
Sequence:CCGGAGCCTGCAGAGTGCAACAATACTCGAGTATTGTTGCACTCTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181558.1-1156s1c1
Sequence:CCGGCCTGCTAATCACATCCACAAACTCGAGTTTGTGGATGTGATTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-571s1c1
Sequence:CCGGGTGCTGCAATTCTACATCTAACTCGAGTTAGATGTAGAATTGCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-639s1c1
Sequence:CCGGCTCCCAGCATTGAAGATGGAACTCGAGTTCCATCTTCAATGCTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_181558.1-380s1c1
Sequence:CCGGGCTGGAAATAGTGACCGAGTACTCGAGTACTCGGTCACTATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181558.1-344s1c1
Sequence:CCGGGCAAGTAACTACCACCTTGAACTCGAGTTCAAGGTGGTAGTTACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)