EMAIL THIS PAGE TO A FRIEND

RFC4

replication factor C (activator 1) 4, 37kDa

70 Gene Product Result for
Synonyms: A1 RFC37
UniProtKB ID: P35249, D3DNV2, Q6FHX7
Gene ID:
Human(5984) Summary: The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(106344) replication factor C (activator 1) 4
Rat(288003) replication factor C (activator 1) 4
fruit fly(38492) Replication factor C subunit 4
chicken(424958) replication factor C (activator 1) 4, 37kDa
Horse(100068189) replication factor C (activator 1) 4, 37kDa
domestic cat(101098886) replication factor C (activator 1) 4, 37kDa
dog(478667) replication factor C (activator 1) 4, 37kDa
Zebrafish(406435) replication factor C (activator 1) 4
cow(504637) replication factor C (activator 1) 4, 37kDa
sheep(101112103) replication factor C (activator 1) 4, 37kDa
Domestic Rabbit(100342140) replication factor C (activator 1) 4, 37kDa
naked mole-rat(101719049) replication factor C (activator 1) 4, 37kDa
domestic guinea pig(100729757) replication factor C (activator 1) 4, 37kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101223 Anti-RFC4 (316-330) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1406384 Anti-RFC4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103339 Anti-RFC4 antibody produced in rabbit affinity isolated antibody bovine, rat, guinea pig, human, mouse, rabbit, horse, canine
western blot pricing
SAB1411190 Anti-RFC4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA049123 Anti-RFC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA058507 Anti-RFC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
PLA0049 Goat anti-RFC4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, human, bovine, primate, gibbon, gorilla, chimpanzee
proximity ligation assay, western blot pricing
WH0005984M1 Monoclonal Anti-RFC4 antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404314 Monoclonal Anti-RFC4, (C-terminal) antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0090 Rabbit anti-RFC4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gorilla, pig, primate, chimpanzee
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002916 Rosetta Predictions human pricing
NM_181573 Rosetta Predictions human pricing
NM_001105869 Rosetta Predictions rat pricing
NM_145480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090177 predicted 1122
2 SASI_Hs01_00090179 predicted 1146
3 SASI_Hs02_00334740 predicted 739
4 SASI_Hs01_00090180 predicted 816
5 SASI_Hs01_00090181 predicted 897
6 SASI_Hs01_00090182 predicted 757
7 SASI_Hs01_00090183 predicted 762
8 SASI_Hs02_00334741 predicted 554
9 SASI_Hs01_00090184 predicted 597
10 SASI_Hs01_00090185 predicted 518
11 SASI_Hs01_00090178 predicted 945
12 SASI_Hs01_00090186 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096794 predicted 1097
2 SASI_Hs01_00096796 predicted 1114
3 SASI_Hs02_00370180 predicted 705
4 SASI_Hs01_00096797 predicted 776
5 SASI_Hs01_00096798 predicted 861
6 SASI_Hs01_00096799 predicted 721
7 SASI_Hs01_00096800 predicted 727
8 SASI_Hs02_00370181 predicted 519
9 SASI_Hs01_00096801 predicted 565
10 SASI_Hs01_00096802 predicted 489
11 SASI_Hs01_00096795 predicted 909
12 SASI_Hs01_00096803 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213332 predicted 706
2 SASI_Rn02_00213333 predicted 444
3 SASI_Rn02_00213334 predicted 661
4 SASI_Rn02_00213335 predicted 663
5 SASI_Rn02_00213336 predicted 710
6 SASI_Rn02_00213337 predicted 576
7 SASI_Rn02_00213338 predicted 566
8 SASI_Rn02_00213339 predicted 319
9 SASI_Rn02_00213340 predicted 359
10 SASI_Rn02_00213341 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112582 predicted 972
2 SASI_Mm01_00112583 predicted 647
3 SASI_Mm01_00112584 predicted 871
4 SASI_Mm01_00112585 predicted 587
5 SASI_Mm01_00112587 predicted 731
6 SASI_Mm02_00340884 predicted 679
7 SASI_Mm01_00112588 predicted 266
8 SASI_Mm01_00112589 predicted 331
9 SASI_Mm01_00112590 predicted 387
10 SASI_Mm01_00112591 predicted 682
11 SASI_Mm01_00112586 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002916
VALIDATED
RFC4 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 4, 37kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-551s1c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-790s1c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-745s1c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-1190s1c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-551s21c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-1190s21c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-745s21c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-790s21c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002916
VALIDATED
RFC4 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 4, 37kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-551s1c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-790s1c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-745s1c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-1190s1c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-551s21c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-1190s21c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-745s21c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-790s21c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002916
VALIDATED
RFC4 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 4, 37kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-551s1c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-790s1c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-745s1c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002916.3-1190s1c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-551s21c1
Sequence:CCGGGCATCTGATGAACGTGGAATACTCGAGTATTCCACGTTCATCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-1190s21c1
Sequence:CCGGCAGAAGTCTATTATCACAGAACTCGAGTTCTGTGATAATAGACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-745s21c1
Sequence:CCGGCCGATTCTGTCTTATCTGTAACTCGAGTTACAGATAAGACAGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002916.3-790s21c1
Sequence:CCGGCCTGACCTCTAGATGTTCAAACTCGAGTTTGAACATCTAGAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145480
VALIDATED
RFC4 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 4, 37kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-928s1c1
Sequence:CCGGGCTGTGGTAAAGAACCTCATACTCGAGTATGAGGTTCTTTACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-479s1c1
Sequence:CCGGGTCCTCCCTTTAAGATTGTAACTCGAGTTACAATCTTAAAGGGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-772s1c1
Sequence:CCGGCGGAAAGCCATCACATTTCTTCTCGAGAAGAAATGTGATGGCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-868s1c1
Sequence:CCGGGCTGCAACCATTGATGGAATACTCGAGTATTCCATCAATGGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-658s1c1
Sequence:CCGGCCTCTGTCAGATAAGATTCAACTCGAGTTGAATCTTATCTGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145480
VALIDATED
RFC4 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 4, 37kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-928s1c1
Sequence:CCGGGCTGTGGTAAAGAACCTCATACTCGAGTATGAGGTTCTTTACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-479s1c1
Sequence:CCGGGTCCTCCCTTTAAGATTGTAACTCGAGTTACAATCTTAAAGGGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-772s1c1
Sequence:CCGGCGGAAAGCCATCACATTTCTTCTCGAGAAGAAATGTGATGGCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-868s1c1
Sequence:CCGGGCTGCAACCATTGATGGAATACTCGAGTATTCCATCAATGGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-658s1c1
Sequence:CCGGCCTCTGTCAGATAAGATTCAACTCGAGTTGAATCTTATCTGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145480
VALIDATED
RFC4 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 4, 37kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-928s1c1
Sequence:CCGGGCTGTGGTAAAGAACCTCATACTCGAGTATGAGGTTCTTTACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-479s1c1
Sequence:CCGGGTCCTCCCTTTAAGATTGTAACTCGAGTTACAATCTTAAAGGGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-772s1c1
Sequence:CCGGCGGAAAGCCATCACATTTCTTCTCGAGAAGAAATGTGATGGCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-868s1c1
Sequence:CCGGGCTGCAACCATTGATGGAATACTCGAGTATTCCATCAATGGTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145480.1-658s1c1
Sequence:CCGGCCTCTGTCAGATAAGATTCAACTCGAGTTGAATCTTATCTGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)