EMAIL THIS PAGE TO A FRIEND

RFC5

replication factor C (activator 1) 5, 36.5kDa

62 Gene Product Result for
Synonyms: RFC36
UniProtKB ID: P40937, A8MZ62, B3KSX8
Gene ID:
Human(5985) Summary: The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 36 kD subunit. This subunit can interact with the C-terminal region of PCNA. It forms a core complex with the 38 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9. [provided by RefSeq, May 2011]
Mouse(72151) replication factor C (activator 1) 5
Rat(304528) replication factor C (activator 1) 5
domestic guinea pig(100723132) replication factor C (activator 1) 5, 36.5kDa
naked mole-rat(101710167) replication factor C (activator 1) 5, 36.5kDa
Domestic Rabbit(100345366) replication factor C (activator 1) 5, 36.5kDa
cow(508389) replication factor C (activator 1) 5, 36.5kDa
sheep(101109740) replication factor C (activator 1) 5, 36.5kDa
Zebrafish(445385) replication factor C (activator 1) 5
chicken(100859719) replication factor C (activator 1) 5, 36.5kDa
Horse(100054946) replication factor C (activator 1) 5, 36.5kDa
domestic cat(101092297) replication factor C (activator 1) 5, 36.5kDa
dog(477499) replication factor C (activator 1) 5, 36.5kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007370 Rosetta Predictions human pricing
NM_181578 Rosetta Predictions human pricing
NM_001107146 Rosetta Predictions rat pricing
NM_028128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127688 predicted 913
2 SASI_Hs01_00127689 predicted 470
3 SASI_Hs01_00127690 predicted 439
4 SASI_Hs01_00127691 predicted 468
5 SASI_Hs01_00127692 predicted 1094
6 SASI_Hs02_00343500 predicted 859
7 SASI_Hs01_00127693 predicted 740
8 SASI_Hs01_00127694 predicted 453
9 SASI_Hs01_00127695 predicted 878
10 SASI_Hs01_00127696 predicted 692
11 SASI_Hs01_00127697 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067764 predicted 1274
2 SASI_Hs01_00067765 predicted 839
3 SASI_Hs01_00067766 predicted 804
4 SASI_Hs01_00067767 predicted 830
5 SASI_Hs01_00067768 predicted 1453
6 SASI_Hs02_00370184 predicted 1222
7 SASI_Hs01_00067769 predicted 1098
8 SASI_Hs01_00067770 predicted 823
9 SASI_Hs01_00067771 predicted 1243
10 SASI_Hs01_00067772 predicted 1058
11 SASI_Hs01_00067773 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225955 predicted 846
2 SASI_Rn02_00225956 predicted 652
3 SASI_Rn02_00225957 predicted 656
4 SASI_Rn02_00225958 predicted 922
5 SASI_Rn02_00225959 predicted 629
6 SASI_Rn02_00225960 predicted 801
7 SASI_Rn02_00225961 predicted 805
8 SASI_Rn02_00225962 predicted 954
9 SASI_Rn02_00225963 predicted 202
10 SASI_Rn02_00225964 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333386 predicted 387
2 SASI_Mm02_00333387 predicted 464
3 SASI_Mm02_00333388 predicted 501
4 SASI_Mm02_00333389 predicted 285
5 SASI_Mm02_00333390 predicted 1154
6 SASI_Mm02_00333391 predicted 382
7 SASI_Mm02_00333392 predicted 702
8 SASI_Mm02_00333393 predicted 616
9 SASI_Mm02_00333394 predicted 549
10 SASI_Mm02_00333395 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007370
RFC5 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 5, 36.5kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-1041s21c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007370.4-1199s21c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-530s21c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1039s1c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-471s1c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-528s1c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1114s1c1
Sequence:CCGGGTCACCAGAGACCTGATTGTTCTCGAGAACAATCAGGTCTCTGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007370.3-1197s1c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-473s21c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007370
RFC5 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 5, 36.5kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-1041s21c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007370.4-1199s21c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-530s21c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1039s1c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-471s1c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-528s1c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1114s1c1
Sequence:CCGGGTCACCAGAGACCTGATTGTTCTCGAGAACAATCAGGTCTCTGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007370.3-1197s1c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-473s21c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007370
RFC5 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 5, 36.5kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-1041s21c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007370.4-1199s21c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-530s21c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1039s1c1
Sequence:CCGGGCAGACATTGAGTACAGGCTTCTCGAGAAGCCTGTACTCAATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-471s1c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-528s1c1
Sequence:CCGGGAATGCCTTGAGAAGAGTAATCTCGAGATTACTCTTCTCAAGGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007370.3-1114s1c1
Sequence:CCGGGTCACCAGAGACCTGATTGTTCTCGAGAACAATCAGGTCTCTGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007370.3-1197s1c1
Sequence:CCGGCAGAGGACAGTTCCAGGATAACTCGAGTTATCCTGGAACTGTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007370.4-473s21c1
Sequence:CCGGGAAAGGCTTTAAGCTAGTGATCTCGAGATCACTAGCTTAAAGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028128
VALIDATED
RFC5 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 5, 36.5kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028128.1-773s21c1
Sequence:CCGGAGACGGACATTGCCAATATACCTCGAGGTATATTGGCAATGTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-926s21c1
Sequence:GTACCGGCTTCAGTTCGGATACACTTATCTCGAGATAAGTGTATCCGAACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-1204s21c1
Sequence:CCGGAGGGCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-449s21c1
Sequence:CCGGACGCCTTGAGACGAGTGATTGCTCGAGCAATCACTCGTCTCAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-322s21c1
Sequence:CCGGGACGACCGAGGGATCGATATTCTCGAGAATATCGATCCCTCGGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028128
VALIDATED
RFC5 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 5, 36.5kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028128.1-773s21c1
Sequence:CCGGAGACGGACATTGCCAATATACCTCGAGGTATATTGGCAATGTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-926s21c1
Sequence:GTACCGGCTTCAGTTCGGATACACTTATCTCGAGATAAGTGTATCCGAACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-1204s21c1
Sequence:CCGGAGGGCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-449s21c1
Sequence:CCGGACGCCTTGAGACGAGTGATTGCTCGAGCAATCACTCGTCTCAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-322s21c1
Sequence:CCGGGACGACCGAGGGATCGATATTCTCGAGAATATCGATCCCTCGGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028128
VALIDATED
RFC5 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 5, 36.5kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028128.1-773s21c1
Sequence:CCGGAGACGGACATTGCCAATATACCTCGAGGTATATTGGCAATGTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-926s21c1
Sequence:GTACCGGCTTCAGTTCGGATACACTTATCTCGAGATAAGTGTATCCGAACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-1204s21c1
Sequence:CCGGAGGGCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-449s21c1
Sequence:CCGGACGCCTTGAGACGAGTGATTGCTCGAGCAATCACTCGTCTCAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028128.1-322s21c1
Sequence:CCGGGACGACCGAGGGATCGATATTCTCGAGAATATCGATCCCTCGGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)