EMAIL THIS PAGE TO A FRIEND

RFESD

Rieske (Fe-S) domain containing

83 Gene Product Result for
UniProtKB ID: Q8TAC1, J3KPH1
Gene ID:
Mouse(218341) Rieske (Fe-S) domain containing
Rat(361871) Rieske (Fe-S) domain containing
Zebrafish(550435) Rieske (Fe-S) domain containing
dog(488902) Rieske (Fe-S) domain containing
chicken(427118) Rieske (Fe-S) domain containing
cow(519915) Rieske (Fe-S) domain containing
sheep(101123040) Rieske (Fe-S) domain containing
naked mole-rat(101700002) Rieske (Fe-S) domain containing
domestic guinea pig(100716221) Rieske (Fe-S) domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103292 Anti-RFESD (25-35) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1103293 Anti-RFESD (91-105) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2103632 Anti-RFESD antibody produced in rabbit affinity isolated antibody rabbit, canine, mouse, guinea pig, horse, rat, human, bovine
western blot pricing
SAB2702128 Anti-RFESD antibody produced in rabbit human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173362 Rosetta Predictions human pricing
NM_001108540 Rosetta Predictions rat pricing
XM_342165 Rosetta Predictions rat pricing
NM_001131068 Rosetta Predictions mouse pricing
NM_001131069 Rosetta Predictions mouse pricing
NM_178916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118496 predicted 1681
2 SASI_Hs01_00118497 predicted 1779
3 SASI_Hs01_00118498 predicted 1756
4 SASI_Hs01_00118500 predicted 1836
5 SASI_Hs01_00118501 predicted 1822
6 SASI_Hs01_00118502 predicted 1717
7 SASI_Hs01_00118503 predicted 1657
8 SASI_Hs01_00118504 predicted 1777
9 SASI_Hs01_00118505 predicted 1912
10 SASI_Hs02_00368192 predicted 1703
11 SASI_Hs01_00118499 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239649 predicted 282
2 SASI_Rn02_00239650 predicted 301
3 SASI_Rn02_00239651 predicted 276
4 SASI_Rn02_00239652 predicted 234
5 SASI_Rn02_00239653 predicted 283
6 SASI_Rn02_00239654 predicted 236
7 SASI_Rn02_00239655 predicted 288
8 SASI_Rn02_00239656 predicted 330
9 SASI_Rn02_00239657 predicted 214
10 SASI_Rn02_00239658 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123329 predicted 318
2 SASI_Rn01_00123330 predicted 317
3 SASI_Rn01_00123331 predicted 320
4 SASI_Rn01_00123332 predicted 328
5 SASI_Rn01_00123333 predicted 308
6 SASI_Rn01_00123334 predicted 319
7 SASI_Rn01_00123335 predicted 317
8 SASI_Rn01_00123336 predicted 386
9 SASI_Rn01_00123337 predicted 207
10 SASI_Rn01_00123338 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311450 predicted 796
2 SASI_Mm02_00311451 predicted 1044
3 SASI_Mm02_00311452 predicted 652
4 SASI_Mm02_00311453 predicted 866
5 SASI_Mm02_00311454 predicted 980
6 SASI_Mm02_00311455 predicted 773
7 SASI_Mm02_00311456 predicted 938
8 SASI_Mm02_00311457 predicted 742
9 SASI_Mm02_00311458 predicted 631
10 SASI_Mm02_00311459 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311460 predicted 508
2 SASI_Mm02_00311461 predicted 330
3 SASI_Mm02_00311462 predicted 425
4 SASI_Mm02_00311463 predicted 258
5 SASI_Mm02_00311464 predicted 471
6 SASI_Mm02_00311465 predicted 419
7 SASI_Mm02_00311466 predicted 328
8 SASI_Mm02_00311467 predicted 244
9 SASI_Mm02_00311468 predicted 404
10 SASI_Mm02_00311469 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169605 predicted 1248
2 SASI_Mm01_00169606 predicted 1494
3 SASI_Mm01_00169607 predicted 1103
4 SASI_Mm01_00169608 predicted 1320
5 SASI_Mm01_00169609 predicted 1429
6 SASI_Mm02_00349533 predicted 1222
7 SASI_Mm02_00349534 predicted 1388
8 SASI_Mm01_00169611 predicted 1485
9 SASI_Mm01_00169612 predicted 1194
10 SASI_Mm01_00169614 predicted 1080
11 SASI_Mm01_00169610 predicted 1344
12 SASI_Mm01_00169613 predicted 1412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173362
VALIDATED
RFESD MISSION shRNA Bacterial Glycerol Stock
Rieske (Fe-S) domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1577s1c1
Sequence:CCGGCCTTTACATTTGGGAGATATACTCGAGTATATCTCCCAAATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1783s1c1
Sequence:CCGGGACTCTTTCTAATGAACCTTTCTCGAGAAAGGTTCATTAGAAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173362.2-1722s1c1
Sequence:CCGGGCTCCAAAGGAATAAAGCAAACTCGAGTTTGCTTTATTCCTTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1828s1c1
Sequence:CCGGCACTGGAGACTTCAAAGTAATCTCGAGATTACTTTGAAGTCTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1667s1c1
Sequence:CCGGGAAGGTCTGTACCAGTCTATACTCGAGTATAGACTGGTACAGACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1758s21c1
Sequence:CCGGGACAGTAGACAACGGAAATATCTCGAGATATTTCCGTTGTCTACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1502s21c1
Sequence:CCGGATGATAGAGAAGTGGTCATTTCTCGAGAAATGACCACTTCTCTATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1546s21c1
Sequence:CCGGGCTATGGATATTCGCTGTTACCTCGAGGTAACAGCGAATATCCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173362
VALIDATED
RFESD MISSION shRNA shRNA Plasmid DNA
Rieske (Fe-S) domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1577s1c1
Sequence:CCGGCCTTTACATTTGGGAGATATACTCGAGTATATCTCCCAAATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1783s1c1
Sequence:CCGGGACTCTTTCTAATGAACCTTTCTCGAGAAAGGTTCATTAGAAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173362.2-1722s1c1
Sequence:CCGGGCTCCAAAGGAATAAAGCAAACTCGAGTTTGCTTTATTCCTTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1828s1c1
Sequence:CCGGCACTGGAGACTTCAAAGTAATCTCGAGATTACTTTGAAGTCTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1667s1c1
Sequence:CCGGGAAGGTCTGTACCAGTCTATACTCGAGTATAGACTGGTACAGACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1758s21c1
Sequence:CCGGGACAGTAGACAACGGAAATATCTCGAGATATTTCCGTTGTCTACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1502s21c1
Sequence:CCGGATGATAGAGAAGTGGTCATTTCTCGAGAAATGACCACTTCTCTATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1546s21c1
Sequence:CCGGGCTATGGATATTCGCTGTTACCTCGAGGTAACAGCGAATATCCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173362
VALIDATED
RFESD MISSION shRNA Lentiviral Transduction Particles
Rieske (Fe-S) domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1577s1c1
Sequence:CCGGCCTTTACATTTGGGAGATATACTCGAGTATATCTCCCAAATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1783s1c1
Sequence:CCGGGACTCTTTCTAATGAACCTTTCTCGAGAAAGGTTCATTAGAAAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173362.2-1722s1c1
Sequence:CCGGGCTCCAAAGGAATAAAGCAAACTCGAGTTTGCTTTATTCCTTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1828s1c1
Sequence:CCGGCACTGGAGACTTCAAAGTAATCTCGAGATTACTTTGAAGTCTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173362.2-1667s1c1
Sequence:CCGGGAAGGTCTGTACCAGTCTATACTCGAGTATAGACTGGTACAGACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1758s21c1
Sequence:CCGGGACAGTAGACAACGGAAATATCTCGAGATATTTCCGTTGTCTACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1502s21c1
Sequence:CCGGATGATAGAGAAGTGGTCATTTCTCGAGAAATGACCACTTCTCTATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173362.3-1546s21c1
Sequence:CCGGGCTATGGATATTCGCTGTTACCTCGAGGTAACAGCGAATATCCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178916
VALIDATED
RFESD MISSION shRNA Bacterial Glycerol Stock
Rieske (Fe-S) domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1205s1c1
Sequence:CCGGCAAAGGAGTAAAGCAAAGGATCTCGAGATCCTTTGCTTTACTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1217s1c1
Sequence:CCGGGCAAAGGATTCACACCGTGAACTCGAGTTCACGGTGTGAATCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178916.2-930s1c1
Sequence:CCGGGCAGAGAAGAGGACATTAGAACTCGAGTTCTAATGTCCTCTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1136s1c1
Sequence:CCGGGCAAGCAGGAGAAGGATTATACTCGAGTATAATCCTTCTCCTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1916s21c1
Sequence:CCGGCCAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178916.5-1437s21c1
Sequence:CCGGACACTTTCTAAGGAACCATTTCTCGAGAAATGGTTCCTTAGAAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1971s21c1
Sequence:CCGGATAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1809s21c1
Sequence:CCGGCACAAGTCATTTACACATAAACTCGAGTTTATGTGTAAATGACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178916
VALIDATED
RFESD MISSION shRNA shRNA Plasmid DNA
Rieske (Fe-S) domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1205s1c1
Sequence:CCGGCAAAGGAGTAAAGCAAAGGATCTCGAGATCCTTTGCTTTACTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1217s1c1
Sequence:CCGGGCAAAGGATTCACACCGTGAACTCGAGTTCACGGTGTGAATCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178916.2-930s1c1
Sequence:CCGGGCAGAGAAGAGGACATTAGAACTCGAGTTCTAATGTCCTCTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1136s1c1
Sequence:CCGGGCAAGCAGGAGAAGGATTATACTCGAGTATAATCCTTCTCCTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1916s21c1
Sequence:CCGGCCAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178916.5-1437s21c1
Sequence:CCGGACACTTTCTAAGGAACCATTTCTCGAGAAATGGTTCCTTAGAAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1971s21c1
Sequence:CCGGATAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1809s21c1
Sequence:CCGGCACAAGTCATTTACACATAAACTCGAGTTTATGTGTAAATGACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178916
VALIDATED
RFESD MISSION shRNA Lentiviral Transduction Particles
Rieske (Fe-S) domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1205s1c1
Sequence:CCGGCAAAGGAGTAAAGCAAAGGATCTCGAGATCCTTTGCTTTACTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1217s1c1
Sequence:CCGGGCAAAGGATTCACACCGTGAACTCGAGTTCACGGTGTGAATCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178916.2-930s1c1
Sequence:CCGGGCAGAGAAGAGGACATTAGAACTCGAGTTCTAATGTCCTCTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178916.2-1136s1c1
Sequence:CCGGGCAAGCAGGAGAAGGATTATACTCGAGTATAATCCTTCTCCTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1916s21c1
Sequence:CCGGCCAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178916.5-1437s21c1
Sequence:CCGGACACTTTCTAAGGAACCATTTCTCGAGAAATGGTTCCTTAGAAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1971s21c1
Sequence:CCGGATAGGTCAACAGGATACATTCCTCGAGGAATGTATCCTGTTGACCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178916.5-1809s21c1
Sequence:CCGGCACAAGTCATTTACACATAAACTCGAGTTTATGTGTAAATGACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)