EMAIL THIS PAGE TO A FRIEND

RFFL

ring finger and FYVE-like domain containing E3 ubiquitin protein ligase

138 Gene Product Result for
Synonyms: CARP-2 CARP2 FRING RIFIFYLIN RNF189 RNF34L
UniProtKB ID: Q8WZ73, E1P633, Q8NHW0, Q8TBY7, Q96BE6
Gene ID:
Mouse(67338) ring finger and FYVE like domain containing protein
Rat(282844) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
chicken(417529) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
domestic cat(101098501) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Horse(100058179) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
dog(491144) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
domestic guinea pig(100715693) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
naked mole-rat(101699936) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
cow(530263) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
sheep(101118456) ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017368 Rosetta Predictions human pricing
NM_057178 Rosetta Predictions human pricing
NM_001004068 Rosetta Predictions rat pricing
NM_001007465 Rosetta Predictions mouse pricing
NM_026097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091515 predicted 525
2 SASI_Hs01_00091516 predicted 1483
3 SASI_Hs01_00091517 predicted 963
4 SASI_Hs01_00091518 predicted 946
5 SASI_Hs01_00091519 predicted 1016
6 SASI_Hs01_00091520 predicted 1471
7 SASI_Hs01_00091521 predicted 487
8 SASI_Hs01_00091522 predicted 1131
9 SASI_Hs01_00091523 predicted 440
10 SASI_Hs01_00091524 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114706 predicted 534
2 SASI_Hs01_00114707 predicted 1487
3 SASI_Hs01_00114708 predicted 964
4 SASI_Hs01_00114709 predicted 954
5 SASI_Hs01_00114710 predicted 1028
6 SASI_Hs01_00114711 predicted 1480
7 SASI_Hs01_00114712 predicted 498
8 SASI_Hs01_00114713 predicted 1138
9 SASI_Hs01_00114714 predicted 446
10 SASI_Hs01_00114715 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044968 predicted 1414
2 SASI_Rn01_00044969 predicted 863
3 SASI_Rn01_00044970 predicted 1310
4 SASI_Rn01_00044971 predicted 1441
5 SASI_Rn01_00044972 predicted 1005
6 SASI_Rn02_00198089 predicted 613
7 SASI_Rn01_00044973 predicted 1155
8 SASI_Rn01_00044974 predicted 1483
9 SASI_Rn01_00044976 predicted 317
10 SASI_Rn01_00044977 predicted 309
11 SASI_Rn01_00044975 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117367 predicted 1475
2 SASI_Mm01_00117369 predicted 1511
3 SASI_Mm01_00117370 predicted 1563
4 SASI_Mm01_00117371 predicted 1386
5 SASI_Mm01_00117372 predicted 1293
6 SASI_Mm01_00117373 predicted 541
7 SASI_Mm01_00117374 predicted 1477
8 SASI_Mm01_00117375 predicted 1314
9 SASI_Mm02_00286732 predicted 1223
10 SASI_Mm01_00117376 predicted 609
11 SASI_Mm01_00117368 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041863 predicted 1408
2 SASI_Mm01_00041865 predicted 1436
3 SASI_Mm01_00041866 predicted 1488
4 SASI_Mm01_00041867 predicted 1316
5 SASI_Mm01_00041868 predicted 1215
6 SASI_Mm01_00041869 predicted 554
7 SASI_Mm01_00041870 predicted 1410
8 SASI_Mm01_00041871 predicted 1249
9 SASI_Mm02_00329672 predicted 1154
10 SASI_Mm01_00041872 predicted 624
11 SASI_Mm01_00041864 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057178
VALIDATED
RFFL MISSION shRNA Bacterial Glycerol Stock
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057178.3-496s21c1
Sequence:CCGGTGAAGGACTTGAGGGACTATCCTCGAGGATAGTCCCTCAAGTCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057178.3-1721s21c1
Sequence:CCGGTCTGTGCTTTAACTATCTTTGCTCGAGCAAAGATAGTTAAAGCACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1232s1c1
Sequence:CCGGGCAGTATGTAATCCGAGCTGTCTCGAGACAGCTCGGATTACATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1028s1c1
Sequence:CCGGCCGGCTATACAAGGATCAGAACTCGAGTTCTGATCCTTGTATAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057178.2-1175s1c1
Sequence:CCGGCCACATGGTAACCTGTACCAACTCGAGTTGGTACAGGTTACCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-524s1c1
Sequence:CCGGCCATGACATCTCTACCGAAATCTCGAGATTTCGGTAGAGATGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-363s1c1
Sequence:CCGGACCTGCTTGGACTGTAAGAAACTCGAGTTTCTTACAGTCCAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057178
VALIDATED
RFFL MISSION shRNA shRNA Plasmid DNA
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057178.3-496s21c1
Sequence:CCGGTGAAGGACTTGAGGGACTATCCTCGAGGATAGTCCCTCAAGTCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057178.3-1721s21c1
Sequence:CCGGTCTGTGCTTTAACTATCTTTGCTCGAGCAAAGATAGTTAAAGCACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1232s1c1
Sequence:CCGGGCAGTATGTAATCCGAGCTGTCTCGAGACAGCTCGGATTACATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1028s1c1
Sequence:CCGGCCGGCTATACAAGGATCAGAACTCGAGTTCTGATCCTTGTATAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057178.2-1175s1c1
Sequence:CCGGCCACATGGTAACCTGTACCAACTCGAGTTGGTACAGGTTACCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-524s1c1
Sequence:CCGGCCATGACATCTCTACCGAAATCTCGAGATTTCGGTAGAGATGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-363s1c1
Sequence:CCGGACCTGCTTGGACTGTAAGAAACTCGAGTTTCTTACAGTCCAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057178
VALIDATED
RFFL MISSION shRNA Lentiviral Transduction Particles
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057178.3-496s21c1
Sequence:CCGGTGAAGGACTTGAGGGACTATCCTCGAGGATAGTCCCTCAAGTCCTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057178.3-1721s21c1
Sequence:CCGGTCTGTGCTTTAACTATCTTTGCTCGAGCAAAGATAGTTAAAGCACAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1232s1c1
Sequence:CCGGGCAGTATGTAATCCGAGCTGTCTCGAGACAGCTCGGATTACATACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-1028s1c1
Sequence:CCGGCCGGCTATACAAGGATCAGAACTCGAGTTCTGATCCTTGTATAGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057178.2-1175s1c1
Sequence:CCGGCCACATGGTAACCTGTACCAACTCGAGTTGGTACAGGTTACCATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-524s1c1
Sequence:CCGGCCATGACATCTCTACCGAAATCTCGAGATTTCGGTAGAGATGTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_057178.2-363s1c1
Sequence:CCGGACCTGCTTGGACTGTAAGAAACTCGAGTTTCTTACAGTCCAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026097
VALIDATED
RFFL MISSION shRNA Bacterial Glycerol Stock
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1164s21c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-654s21c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1013s21c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-492s21c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-655s1c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-493s1c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1165s1c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026097.1-1076s1c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1014s1c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1075s21c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026097
VALIDATED
RFFL MISSION shRNA shRNA Plasmid DNA
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1164s21c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-654s21c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1013s21c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-492s21c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-655s1c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-493s1c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1165s1c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026097.1-1076s1c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1014s1c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1075s21c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026097
VALIDATED
RFFL MISSION shRNA Lentiviral Transduction Particles
ring finger and FYVE-like domain containing E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1164s21c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-654s21c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1013s21c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-492s21c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-655s1c1
Sequence:CCGGCCACGACATCTCTACGGAAATCTCGAGATTTCCGTAGAGATGTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-493s1c1
Sequence:CCGGGACCTGCTTGGACTGTAAGAACTCGAGTTCTTACAGTCCAAGCAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1165s1c1
Sequence:CCGGGAACCTGTGTAAGATTTGCATCTCGAGATGCAAATCTTACACAGGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026097.1-1076s1c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026097.1-1014s1c1
Sequence:CCGGCTCGTAACTTTGTCAACTATACTCGAGTATAGTTGACAAAGTTACGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026097.2-1075s21c1
Sequence:CCGGCGGCTGTACAAGGATCAGAAACTCGAGTTTCTGATCCTTGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)