EMAIL THIS PAGE TO A FRIEND

RFK

riboflavin kinase

94 Gene Product Result for
Synonyms: RIFK
UniProtKB ID: Q969G6, Q5JSG9, Q9NUT7
Gene ID:
Human(55312) Summary: Riboflavin kinase (RFK; EC 2.7.1.26) is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis (Karthikeyan et al., 2003 [PubMed 12623014]
Mouse(54391) riboflavin kinase
Rat(499328) riboflavin kinase
Zebrafish(560915) riboflavin kinase
domestic cat(101096678) riboflavin kinase
dog(484159) riboflavin kinase
chicken(431449) riboflavin kinase
cow(514697) riboflavin kinase
naked mole-rat(101712331) riboflavin kinase
domestic guinea pig(100729926) riboflavin kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018339 Rosetta Predictions human pricing
NM_001014106 Rosetta Predictions rat pricing
XM_001077991 Rosetta Predictions rat pricing
XM_574634 Rosetta Predictions rat pricing
NM_019437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091216 predicted 458
2 SASI_Hs01_00091217 predicted 542
3 SASI_Hs01_00091218 predicted 689
4 SASI_Hs01_00091219 predicted 727
5 SASI_Hs01_00091220 predicted 589
6 SASI_Hs01_00091221 predicted 519
7 SASI_Hs01_00091222 predicted 544
8 SASI_Hs01_00091223 predicted 574
9 SASI_Hs01_00091224 predicted 737
10 SASI_Hs02_00351785 predicted 585
11 SASI_Hs01_00091215 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201545 predicted 673
2 SASI_Rn02_00201546 predicted 581
3 SASI_Rn02_00201547 predicted 344
4 SASI_Rn01_00091290 predicted 1002
5 SASI_Rn02_00201548 predicted 472
6 SASI_Rn01_00091291 predicted 594
7 SASI_Rn01_00091292 predicted 834
8 SASI_Rn01_00091294 predicted 763
9 SASI_Rn01_00091295 predicted 370
10 SASI_Rn01_00091298 predicted 772
11 SASI_Rn01_00091289 predicted 587
12 SASI_Rn01_00091293 predicted 498
13 SASI_Rn01_00091296 predicted 877
14 SASI_Rn01_00091297 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359262 predicted 342
2 SASI_Rn02_00359263 predicted 595
3 SASI_Rn02_00359264 predicted 832
4 SASI_Rn02_00359265 predicted 462
5 SASI_Rn02_00359266 predicted 765
6 SASI_Rn02_00359267 predicted 647
7 SASI_Rn02_00359268 predicted 374
8 SASI_Rn02_00359269 predicted 453
9 SASI_Rn02_00359270 predicted 776
10 SASI_Rn02_00359271 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126191 predicted 587
2 SASI_Rn01_00126192 predicted 1002
3 SASI_Rn01_00126193 predicted 596
4 SASI_Rn01_00126194 predicted 841
5 SASI_Rn01_00126195 predicted 501
6 SASI_Rn01_00126196 predicted 774
7 SASI_Rn01_00126197 predicted 375
8 SASI_Rn01_00126198 predicted 873
9 SASI_Rn01_00126199 predicted 658
10 SASI_Rn01_00126200 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167327 predicted 695
2 SASI_Mm01_00167328 predicted 602
3 SASI_Mm01_00167329 predicted 559
4 SASI_Mm01_00167330 predicted 410
5 SASI_Mm02_00324384 predicted 432
6 SASI_Mm01_00167332 predicted 615
7 SASI_Mm02_00324385 predicted 516
8 SASI_Mm01_00167333 predicted 418
9 SASI_Mm01_00167334 predicted 338
10 SASI_Mm01_00167335 predicted 751
11 SASI_Mm01_00167326 predicted 470
12 SASI_Mm01_00167331 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018339
VALIDATED
RFK MISSION shRNA Bacterial Glycerol Stock
riboflavin kinase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-550s1c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-595s1c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-437s1c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-731s1c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018339.3-764s1c1
Sequence:CCGGGAAGACAATTTCTTCCAGGTTCTCGAGAACCTGGAAGAAATTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018339.3-1502s1c1
Sequence:CCGGCCACCTTCATTATTGTATAGACTCGAGTCTATACAATAATGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-561s21c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-448s21c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-742s21c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-485s21c1
Sequence:CCGGCCACTGGTATTTACTATGGTTCTCGAGAACCATAGTAAATACCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-606s21c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018339
VALIDATED
RFK MISSION shRNA shRNA Plasmid DNA
riboflavin kinase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-550s1c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-595s1c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-437s1c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-731s1c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018339.3-764s1c1
Sequence:CCGGGAAGACAATTTCTTCCAGGTTCTCGAGAACCTGGAAGAAATTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018339.3-1502s1c1
Sequence:CCGGCCACCTTCATTATTGTATAGACTCGAGTCTATACAATAATGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-561s21c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-448s21c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-742s21c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-485s21c1
Sequence:CCGGCCACTGGTATTTACTATGGTTCTCGAGAACCATAGTAAATACCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-606s21c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018339
VALIDATED
RFK MISSION shRNA Lentiviral Transduction Particles
riboflavin kinase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-550s1c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-595s1c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-437s1c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018339.3-731s1c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018339.3-764s1c1
Sequence:CCGGGAAGACAATTTCTTCCAGGTTCTCGAGAACCTGGAAGAAATTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018339.3-1502s1c1
Sequence:CCGGCCACCTTCATTATTGTATAGACTCGAGTCTATACAATAATGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-561s21c1
Sequence:CCGGCCCATATTACAAGAATACGAACTCGAGTTCGTATTCTTGTAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-448s21c1
Sequence:CCGGCCTGAGCAAGTGGTAGATAATCTCGAGATTATCTACCACTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-742s21c1
Sequence:CCGGCGACTAGAGTTACCAGAACATCTCGAGATGTTCTGGTAACTCTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-485s21c1
Sequence:CCGGCCACTGGTATTTACTATGGTTCTCGAGAACCATAGTAAATACCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018339.4-606s21c1
Sequence:CCGGGCATACCTTCAAAGAGGACTTCTCGAGAAGTCCTCTTTGAAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019437
VALIDATED
RFK MISSION shRNA Bacterial Glycerol Stock
riboflavin kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-433s1c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-626s1c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-565s1c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-1682s1c1
Sequence:CCGGCCAGGCACTTAAACATAATTTCTCGAGAAATTATGTTTAAGTGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-320s1c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-564s21c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-625s21c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-432s21c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-319s21c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019437
VALIDATED
RFK MISSION shRNA shRNA Plasmid DNA
riboflavin kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-433s1c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-626s1c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-565s1c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-1682s1c1
Sequence:CCGGCCAGGCACTTAAACATAATTTCTCGAGAAATTATGTTTAAGTGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-320s1c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-564s21c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-625s21c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-432s21c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-319s21c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019437
VALIDATED
RFK MISSION shRNA Lentiviral Transduction Particles
riboflavin kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-433s1c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-626s1c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-565s1c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-1682s1c1
Sequence:CCGGCCAGGCACTTAAACATAATTTCTCGAGAAATTATGTTTAAGTGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019437.1-320s1c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-564s21c1
Sequence:CCGGAGAGTCACTTATTTCTGCAATCTCGAGATTGCAGAAATAAGTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-625s21c1
Sequence:CCGGCCCGAACATTTGAAACTCAAACTCGAGTTTGAGTTTCAAATGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-432s21c1
Sequence:CCGGCCCGTACTATAAGAATGTGAACTCGAGTTCACATTCTTATAGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019437.2-319s21c1
Sequence:CCGGCCTGAACAAGTGGTGGACAATCTCGAGATTGTCCACCACTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)