EMAIL THIS PAGE TO A FRIEND

RFPL2

ret finger protein-like 2

23 Gene Product Result for
Synonyms: RNF79
Species: Human RFPL2(10739)
UniProtKB ID: O75678
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006605 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109391 MISSION® esiRNA esiRNA human RFPL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098527 Rosetta Predictions human pricing
NM_006605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319327 predicted 358
2 SASI_Hs02_00319328 predicted 352
3 SASI_Hs02_00319329 predicted 158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082714 predicted 637
2 SASI_Hs01_00082715 predicted 639
3 SASI_Hs01_00082713 predicted 439
4 SASI_Hs01_00082716 predicted 1348
5 SASI_Hs01_00082717 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006605
RFPL2 MISSION shRNA Bacterial Glycerol Stock
ret finger protein-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1342s21c1
Sequence:CCGGTCAAACTCATTGAGTCCTATGCTCGAGCATAGGACTCAATGAGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1304s21c1
Sequence:CCGGTTAGATTATAGAGTCCTAAGTCTCGAGACTTAGGACTCTATAATCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006605.3-445s21c1
Sequence:CCGGCTCTTCCATGGTCTCTCGGAACTCGAGTTCCGAGAGACCATGGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1218s21c1
Sequence:CCGGAGGAACGCTCTACTTCGTAAACTCGAGTTTACGAAGTAGAGCGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-379s1c1
Sequence:CCGGCGTCTGCCTCAAGTGCATTAACTCGAGTTAATGCACTTGAGGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-1004s1c1
Sequence:CCGGGTCTATACATTCAGGAGCGTACTCGAGTACGCTCCTGAATGTATAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-433s1c1
Sequence:CCGGGCTTTGCTGTTACTCTTCCATCTCGAGATGGAAGAGTAACAGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-911s1c1
Sequence:CCGGCTCTTCGTAGACCGCAAGTTACTCGAGTAACTTGCGGTCTACGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-532s1c1
Sequence:CCGGGCTGAAGAAGATTCTGCAGATCTCGAGATCTGCAGAATCTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006605
RFPL2 MISSION shRNA shRNA Plasmid DNA
ret finger protein-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1342s21c1
Sequence:CCGGTCAAACTCATTGAGTCCTATGCTCGAGCATAGGACTCAATGAGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1304s21c1
Sequence:CCGGTTAGATTATAGAGTCCTAAGTCTCGAGACTTAGGACTCTATAATCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006605.3-445s21c1
Sequence:CCGGCTCTTCCATGGTCTCTCGGAACTCGAGTTCCGAGAGACCATGGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1218s21c1
Sequence:CCGGAGGAACGCTCTACTTCGTAAACTCGAGTTTACGAAGTAGAGCGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-379s1c1
Sequence:CCGGCGTCTGCCTCAAGTGCATTAACTCGAGTTAATGCACTTGAGGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-1004s1c1
Sequence:CCGGGTCTATACATTCAGGAGCGTACTCGAGTACGCTCCTGAATGTATAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-433s1c1
Sequence:CCGGGCTTTGCTGTTACTCTTCCATCTCGAGATGGAAGAGTAACAGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-911s1c1
Sequence:CCGGCTCTTCGTAGACCGCAAGTTACTCGAGTAACTTGCGGTCTACGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-532s1c1
Sequence:CCGGGCTGAAGAAGATTCTGCAGATCTCGAGATCTGCAGAATCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006605
RFPL2 MISSION shRNA Lentiviral Transduction Particles
ret finger protein-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1342s21c1
Sequence:CCGGTCAAACTCATTGAGTCCTATGCTCGAGCATAGGACTCAATGAGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1304s21c1
Sequence:CCGGTTAGATTATAGAGTCCTAAGTCTCGAGACTTAGGACTCTATAATCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006605.3-445s21c1
Sequence:CCGGCTCTTCCATGGTCTCTCGGAACTCGAGTTCCGAGAGACCATGGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006605.3-1218s21c1
Sequence:CCGGAGGAACGCTCTACTTCGTAAACTCGAGTTTACGAAGTAGAGCGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-379s1c1
Sequence:CCGGCGTCTGCCTCAAGTGCATTAACTCGAGTTAATGCACTTGAGGCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-1004s1c1
Sequence:CCGGGTCTATACATTCAGGAGCGTACTCGAGTACGCTCCTGAATGTATAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-433s1c1
Sequence:CCGGGCTTTGCTGTTACTCTTCCATCTCGAGATGGAAGAGTAACAGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-911s1c1
Sequence:CCGGCTCTTCGTAGACCGCAAGTTACTCGAGTAACTTGCGGTCTACGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006605.1-532s1c1
Sequence:CCGGGCTGAAGAAGATTCTGCAGATCTCGAGATCTGCAGAATCTTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)