EMAIL THIS PAGE TO A FRIEND

RFPL3

ret finger protein-like 3

29 Gene Product Result for
Species: Human RFPL3(10738)
UniProtKB ID: O75679, A2A279, Q6IC03, Q6IC04, Q6NSX3, Q8N5R4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098535 Rosetta Predictions human pricing
NM_006604 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319390 predicted 796
2 SASI_Hs02_00319391 predicted 640
3 SASI_Hs02_00319392 predicted 639
4 SASI_Hs02_00319393 predicted 1253
5 SASI_Hs02_00319394 predicted 1233
6 SASI_Hs02_00319395 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184243 predicted 528
2 SASI_Hs01_00184244 predicted 365
3 SASI_Hs01_00184245 predicted 365
4 SASI_Hs01_00184246 predicted 1013
5 SASI_Hs01_00184247 predicted 1156
6 SASI_Hs01_00184248 predicted 1163
7 SASI_Hs01_00184249 predicted 965
8 SASI_Hs01_00184250 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006604
VALIDATED
RFPL3 MISSION shRNA Bacterial Glycerol Stock
ret finger protein-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-253s21c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006604.1-433s1c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-1055s1c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-565s1c1
Sequence:CCGGGCGGAAGTTCCAAGTGGATATCTCGAGATATCCACTTGGAACTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-899s1c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-527s1c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-159s21c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-625s21c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-781s21c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006604
VALIDATED
RFPL3 MISSION shRNA shRNA Plasmid DNA
ret finger protein-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-253s21c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006604.1-433s1c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-1055s1c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-565s1c1
Sequence:CCGGGCGGAAGTTCCAAGTGGATATCTCGAGATATCCACTTGGAACTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-899s1c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-527s1c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-159s21c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-625s21c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-781s21c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006604
VALIDATED
RFPL3 MISSION shRNA Lentiviral Transduction Particles
ret finger protein-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-253s21c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006604.1-433s1c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-1055s1c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-565s1c1
Sequence:CCGGGCGGAAGTTCCAAGTGGATATCTCGAGATATCCACTTGGAACTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-899s1c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006604.1-527s1c1
Sequence:CCGGCCCAAGCTGAAGAAGATTCTACTCGAGTAGAATCTTCTTCAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-159s21c1
Sequence:CCGGGCTTTGCTGTTGCTGTTCCATCTCGAGATGGAACAGCAACAGCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-625s21c1
Sequence:CCGGCCGCTGACTTTCCTCTTAGTACTCGAGTACTAAGAGGAAAGTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006604.2-781s21c1
Sequence:CCGGGCTCCTTCAATTCCACCTAATCTCGAGATTAGGTGGAATTGAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)