EMAIL THIS PAGE TO A FRIEND

RFPL4A

ret finger protein-like 4A

54 Gene Product Result for
Synonyms: RFPL4 RNF210
UniProtKB ID: A6NLU0
Gene ID:
Rat(292583) ret finger protein-like 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001718457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718457 Rosetta Predictions human pricing
XM_001719234 Rosetta Predictions human pricing
XM_292796 Rosetta Predictions human pricing
NM_001106222 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424046 predicted 700
2 SASI_Hs02_00424047 predicted 534
3 SASI_Hs02_00424048 predicted 664
4 SASI_Hs02_00424049 predicted 510
5 SASI_Hs02_00424050 predicted 671
6 SASI_Hs02_00424051 predicted 228
7 SASI_Hs02_00424052 predicted 226
8 SASI_Hs02_00424053 predicted 271
9 SASI_Hs02_00424054 predicted 654
10 SASI_Hs02_00424055 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00428971 predicted 1097
2 SASI_Hs02_00428972 predicted 526
3 SASI_Hs02_00428973 predicted 619
4 SASI_Hs02_00428974 predicted 533
5 SASI_Hs02_00428975 predicted 367
6 SASI_Hs02_00428976 predicted 271
7 SASI_Hs02_00428977 predicted 608
8 SASI_Hs02_00428978 predicted 1178
9 SASI_Hs02_00428979 predicted 901
10 SASI_Hs02_00428980 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479100 predicted 537
2 SASI_Hs01_00277778 predicted 504
3 SASI_Hs01_00277779 predicted 671
4 SASI_Hs01_00277780 predicted 233
5 SASI_Hs01_00277781 predicted 225
6 SASI_Hs01_00277782 predicted 265
7 SASI_Hs02_00479101 predicted 658
8 SASI_Hs02_00479102 predicted 549
9 SASI_Hs02_00479103 predicted 310
10 SASI_Hs02_00479104 predicted 301
11 SASI_Hs01_00277773 predicted 407
12 SASI_Hs01_00277774 predicted 387
13 SASI_Hs01_00277775 predicted 927
14 SASI_Hs01_00277776 predicted 414
15 SASI_Hs01_00277777 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216838 predicted 410
2 SASI_Rn02_00216839 predicted 1006
3 SASI_Rn02_00216840 predicted 529
4 SASI_Rn02_00216841 predicted 296
5 SASI_Rn02_00216842 predicted 901
6 SASI_Rn02_00216843 predicted 1168
7 SASI_Rn02_00216844 predicted 1148
8 SASI_Rn02_00216845 predicted 1082
9 SASI_Rn02_00216846 predicted 534
10 SASI_Rn02_00216847 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718457
RFPL4A MISSION shRNA Bacterial Glycerol Stock
ret finger protein-like 4A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-58s21c1
Sequence:CCGGGGAGACACCCTCTGGTATAAACTCGAGTTTATACCAGAGGGTGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-235s21c1
Sequence:CCGGGTGCAACTGAAATGTGGATATCTCGAGATATCCACATTTCAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-485s21c1
Sequence:CCGGCCAACAACTATCTCATCATTTCTCGAGAAATGATGAGATAGTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-399s21c1
Sequence:CCGGACTAGAGCCCAAGCTGAAATCCTCGAGGATTTCAGCTTGGGCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-180s21c1
Sequence:GTACCGGGCACTTCAAACAGATCATTAGCTCGAGCTAATGATCTGTTTGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718457
RFPL4A MISSION shRNA shRNA Plasmid DNA
ret finger protein-like 4A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-58s21c1
Sequence:CCGGGGAGACACCCTCTGGTATAAACTCGAGTTTATACCAGAGGGTGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-235s21c1
Sequence:CCGGGTGCAACTGAAATGTGGATATCTCGAGATATCCACATTTCAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-485s21c1
Sequence:CCGGCCAACAACTATCTCATCATTTCTCGAGAAATGATGAGATAGTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-399s21c1
Sequence:CCGGACTAGAGCCCAAGCTGAAATCCTCGAGGATTTCAGCTTGGGCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-180s21c1
Sequence:GTACCGGGCACTTCAAACAGATCATTAGCTCGAGCTAATGATCTGTTTGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718457
RFPL4A MISSION shRNA Lentiviral Transduction Particles
ret finger protein-like 4A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-58s21c1
Sequence:CCGGGGAGACACCCTCTGGTATAAACTCGAGTTTATACCAGAGGGTGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-235s21c1
Sequence:CCGGGTGCAACTGAAATGTGGATATCTCGAGATATCCACATTTCAGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-485s21c1
Sequence:CCGGCCAACAACTATCTCATCATTTCTCGAGAAATGATGAGATAGTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-399s21c1
Sequence:CCGGACTAGAGCCCAAGCTGAAATCCTCGAGGATTTCAGCTTGGGCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718457.1-180s21c1
Sequence:GTACCGGGCACTTCAAACAGATCATTAGCTCGAGCTAATGATCTGTTTGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)