EMAIL THIS PAGE TO A FRIEND

RFPL4AL1

ret finger protein-like 4A-like 1

10 Gene Product Result for
Species: Human RFPL4AL1(729974)
UniProtKB ID: F8VTS6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001131933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001131933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001131933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131933 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388842 predicted 561
2 SASI_Hs02_00388843 predicted 276
3 SASI_Hs02_00388844 predicted 529
4 SASI_Hs02_00388845 predicted 373
5 SASI_Hs02_00388846 predicted 540
6 SASI_Hs02_00388847 predicted 517
7 SASI_Hs02_00388848 predicted 564
8 SASI_Hs02_00388849 predicted 422
9 SASI_Hs02_00388850 predicted 597
10 SASI_Hs02_00388851 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001131933
RFPL4AL1 MISSION shRNA Bacterial Glycerol Stock
ret finger protein-like 4A-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-103s21c1
Sequence:CCGGTGCAACTGAAATGTGGATATGCTCGAGCATATCCACATTTCAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-700s21c1
Sequence:CCGGATGTAGGTATGAGGTCCATTGCTCGAGCAATGGACCTCATACCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-279s21c1
Sequence:CCGGCTGAAATCTGTTCTAACAATGCTCGAGCATTGTTAGAACAGATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-65s21c1
Sequence:CCGGTAGATGTCCTGTCTGTCTAAACTCGAGTTTAGACAGACAGGACATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-353s21c1
Sequence:CCGGCAACAACTATCTCATCATTTCCTCGAGGAAATGATGAGATAGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001131933
RFPL4AL1 MISSION shRNA shRNA Plasmid DNA
ret finger protein-like 4A-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-103s21c1
Sequence:CCGGTGCAACTGAAATGTGGATATGCTCGAGCATATCCACATTTCAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-700s21c1
Sequence:CCGGATGTAGGTATGAGGTCCATTGCTCGAGCAATGGACCTCATACCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-279s21c1
Sequence:CCGGCTGAAATCTGTTCTAACAATGCTCGAGCATTGTTAGAACAGATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-65s21c1
Sequence:CCGGTAGATGTCCTGTCTGTCTAAACTCGAGTTTAGACAGACAGGACATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-353s21c1
Sequence:CCGGCAACAACTATCTCATCATTTCCTCGAGGAAATGATGAGATAGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001131933
RFPL4AL1 MISSION shRNA Lentiviral Transduction Particles
ret finger protein-like 4A-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-103s21c1
Sequence:CCGGTGCAACTGAAATGTGGATATGCTCGAGCATATCCACATTTCAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-700s21c1
Sequence:CCGGATGTAGGTATGAGGTCCATTGCTCGAGCAATGGACCTCATACCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-279s21c1
Sequence:CCGGCTGAAATCTGTTCTAACAATGCTCGAGCATTGTTAGAACAGATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-65s21c1
Sequence:CCGGTAGATGTCCTGTCTGTCTAAACTCGAGTTTAGACAGACAGGACATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131933.1-353s21c1
Sequence:CCGGCAACAACTATCTCATCATTTCCTCGAGGAAATGATGAGATAGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)