EMAIL THIS PAGE TO A FRIEND

RFT1

RFT1 homolog (S. cerevisiae)

77 Gene Product Result for
Synonyms: CDG1N
UniProtKB ID: Q96AA3, Q96J03
Gene ID:
Human(91869) Summary: This gene encodes an enzyme which catalyzes the translocation of the Man(5)GlcNAc (2)-PP-Dol intermediate from the cytoplasmic to the luminal side of the endoplasmic reticulum membrane in the pathway for the N-glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type In.[provided by RefSeq, Dec 2008]
Mouse(328370) RFT1 homolog (S. cerevisiae)
Rat(290552) RFT1 homolog (S. cerevisiae)
naked mole-rat(101718990) RFT1 homolog (S. cerevisiae)
domestic guinea pig(100726530) RFT1 homolog (S. cerevisiae)
cow(504597) RFT1 homolog (S. cerevisiae)
sheep(101107904) RFT1 homolog (S. cerevisiae)
Zebrafish(559873) RFT1 homolog (S. cerevisiae)
chicken(770487) RFT1 homolog (S. cerevisiae)
dog(476589) RFT1 homolog (S. cerevisiae)
domestic cat(101093671) RFT1 homolog (S. cerevisiae)
Horse(100059676) RFT1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052859 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052859 Rosetta Predictions human pricing
XM_001063006 Rosetta Predictions rat pricing
XM_214262 Rosetta Predictions rat pricing
NM_177815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361553 predicted 618
2 SASI_Hs01_00077629 predicted 1213
3 SASI_Hs01_00077630 predicted 364
4 SASI_Hs01_00077631 predicted 969
5 SASI_Hs01_00077632 predicted 810
6 SASI_Hs01_00077633 predicted 410
7 SASI_Hs01_00077634 predicted 818
8 SASI_Hs01_00077635 predicted 706
9 SASI_Hs02_00361554 predicted 762
10 SASI_Hs01_00077636 predicted 521
11 SASI_Hs01_00077628 predicted 640
12 SASI_Hs01_00077637 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305419 predicted 194
2 SASI_Rn02_00305420 predicted 869
3 SASI_Rn02_00305421 predicted 710
4 SASI_Rn02_00305422 predicted 1708
5 SASI_Rn02_00305423 predicted 485
6 SASI_Rn02_00305424 predicted 1246
7 SASI_Rn02_00305425 predicted 936
8 SASI_Rn02_00305426 predicted 1098
9 SASI_Rn02_00305427 predicted 1171
10 SASI_Rn02_00305428 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375189 predicted 1614
2 SASI_Rn02_00375190 predicted 1831
3 SASI_Rn02_00375191 predicted 1750
4 SASI_Rn02_00375192 predicted 1449
5 SASI_Rn02_00375193 predicted 1795
6 SASI_Rn02_00375194 predicted 1710
7 SASI_Rn02_00375195 predicted 1607
8 SASI_Rn02_00375196 predicted 1884
9 SASI_Rn02_00375197 predicted 1892
10 SASI_Rn02_00375198 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348264 predicted 445
2 SASI_Mm02_00348265 predicted 1368
3 SASI_Mm02_00348266 predicted 297
4 SASI_Mm02_00348267 predicted 655
5 SASI_Mm02_00348268 predicted 622
6 SASI_Mm02_00348269 predicted 859
7 SASI_Mm02_00348270 predicted 606
8 SASI_Mm02_00348271 predicted 700
9 SASI_Mm02_00348272 predicted 862
10 SASI_Mm02_00348273 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177815
RFT1 MISSION shRNA Bacterial Glycerol Stock
RFT1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-303s21c1
Sequence:CCGGACTGTCCCACTGGGTATATTTCTCGAGAAATATACCCAGTGGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-852s21c1
Sequence:CCGGTTTGGCGATCAGGGTGTATATCTCGAGATATACACCCTGATCGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.3-1874s1c1
Sequence:CCGGCTTTGAGTGTGATTGACCTTTCTCGAGAAAGGTCAATCACACTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-703s21c1
Sequence:CCGGCACAACTGTTGCCCAGTATTTCTCGAGAAATACTGGGCAACAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-98s21c1
Sequence:CCGGGCAGGTCTTGTTTCGATTAATCTCGAGATTAATCGAAACAAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.2-1585s1c1
Sequence:CCGGGCTGGCCTTAAACTCAGAGATCTCGAGATCTCTGAGTTTAAGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177815.2-186s1c1
Sequence:CCGGGCTTTACTCAACCACAACCTTCTCGAGAAGGTTGTGGTTGAGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177815.3-1979s21c1
Sequence:CCGGGCCGCAAGAATGGTTAGTTTCCTCGAGGAAACTAACCATTCTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177815
RFT1 MISSION shRNA shRNA Plasmid DNA
RFT1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-303s21c1
Sequence:CCGGACTGTCCCACTGGGTATATTTCTCGAGAAATATACCCAGTGGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-852s21c1
Sequence:CCGGTTTGGCGATCAGGGTGTATATCTCGAGATATACACCCTGATCGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.3-1874s1c1
Sequence:CCGGCTTTGAGTGTGATTGACCTTTCTCGAGAAAGGTCAATCACACTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-703s21c1
Sequence:CCGGCACAACTGTTGCCCAGTATTTCTCGAGAAATACTGGGCAACAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-98s21c1
Sequence:CCGGGCAGGTCTTGTTTCGATTAATCTCGAGATTAATCGAAACAAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.2-1585s1c1
Sequence:CCGGGCTGGCCTTAAACTCAGAGATCTCGAGATCTCTGAGTTTAAGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177815.2-186s1c1
Sequence:CCGGGCTTTACTCAACCACAACCTTCTCGAGAAGGTTGTGGTTGAGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177815.3-1979s21c1
Sequence:CCGGGCCGCAAGAATGGTTAGTTTCCTCGAGGAAACTAACCATTCTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177815
RFT1 MISSION shRNA Lentiviral Transduction Particles
RFT1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-303s21c1
Sequence:CCGGACTGTCCCACTGGGTATATTTCTCGAGAAATATACCCAGTGGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-852s21c1
Sequence:CCGGTTTGGCGATCAGGGTGTATATCTCGAGATATACACCCTGATCGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.3-1874s1c1
Sequence:CCGGCTTTGAGTGTGATTGACCTTTCTCGAGAAAGGTCAATCACACTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-703s21c1
Sequence:CCGGCACAACTGTTGCCCAGTATTTCTCGAGAAATACTGGGCAACAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177815.3-98s21c1
Sequence:CCGGGCAGGTCTTGTTTCGATTAATCTCGAGATTAATCGAAACAAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177815.2-1585s1c1
Sequence:CCGGGCTGGCCTTAAACTCAGAGATCTCGAGATCTCTGAGTTTAAGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177815.2-186s1c1
Sequence:CCGGGCTTTACTCAACCACAACCTTCTCGAGAAGGTTGTGGTTGAGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177815.3-1979s21c1
Sequence:CCGGGCCGCAAGAATGGTTAGTTTCCTCGAGGAAACTAACCATTCTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052859
VALIDATED
RFT1 MISSION shRNA Bacterial Glycerol Stock
RFT1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-718s21c1
Sequence:CCGGACAGATCTGTTACCCAATATTCTCGAGAATATTGGGTAACAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-178s21c1
Sequence:CCGGGAAATCGTTGGCGTAGTAAATCTCGAGATTTACTACGCCAACGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-740s21c1
Sequence:CCGGCAAGAAATGGAGCGTTTATAACTCGAGTTATAAACGCTCCATTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-1251s21c1
Sequence:CCGGGGAGGTCGACAGGTACAATTTCTCGAGAAATTGTACCTGTCGACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052859.3-2590s21c1
Sequence:CCGGACTCTATATGGCTAGTATTACCTCGAGGTAATACTAGCCATATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052859.2-181s1c1
Sequence:CCGGGCGTAGTAAATGTAAGACTAACTCGAGTTAGTCTTACATTTACTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052859.2-1994s1c1
Sequence:CCGGGCTCCAACAAACTATATCTTACTCGAGTAAGATATAGTTTGTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052859
VALIDATED
RFT1 MISSION shRNA shRNA Plasmid DNA
RFT1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-718s21c1
Sequence:CCGGACAGATCTGTTACCCAATATTCTCGAGAATATTGGGTAACAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-178s21c1
Sequence:CCGGGAAATCGTTGGCGTAGTAAATCTCGAGATTTACTACGCCAACGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-740s21c1
Sequence:CCGGCAAGAAATGGAGCGTTTATAACTCGAGTTATAAACGCTCCATTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-1251s21c1
Sequence:CCGGGGAGGTCGACAGGTACAATTTCTCGAGAAATTGTACCTGTCGACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052859.3-2590s21c1
Sequence:CCGGACTCTATATGGCTAGTATTACCTCGAGGTAATACTAGCCATATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052859.2-181s1c1
Sequence:CCGGGCGTAGTAAATGTAAGACTAACTCGAGTTAGTCTTACATTTACTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052859.2-1994s1c1
Sequence:CCGGGCTCCAACAAACTATATCTTACTCGAGTAAGATATAGTTTGTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052859
VALIDATED
RFT1 MISSION shRNA Lentiviral Transduction Particles
RFT1 homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-718s21c1
Sequence:CCGGACAGATCTGTTACCCAATATTCTCGAGAATATTGGGTAACAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-178s21c1
Sequence:CCGGGAAATCGTTGGCGTAGTAAATCTCGAGATTTACTACGCCAACGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-740s21c1
Sequence:CCGGCAAGAAATGGAGCGTTTATAACTCGAGTTATAAACGCTCCATTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_052859.3-1251s21c1
Sequence:CCGGGGAGGTCGACAGGTACAATTTCTCGAGAAATTGTACCTGTCGACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052859.3-2590s21c1
Sequence:CCGGACTCTATATGGCTAGTATTACCTCGAGGTAATACTAGCCATATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052859.2-181s1c1
Sequence:CCGGGCGTAGTAAATGTAAGACTAACTCGAGTTAGTCTTACATTTACTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052859.2-1994s1c1
Sequence:CCGGGCTCCAACAAACTATATCTTACTCGAGTAAGATATAGTTTGTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)