EMAIL THIS PAGE TO A FRIEND

RFWD3

ring finger and WD repeat domain 3

98 Gene Product Result for
Synonyms: RNF201
Gene ID:
Mouse(234736) ring finger and WD repeat domain 3
Rat(361409) ring finger and WD repeat domain 3
chicken(415684) ring finger and WD repeat domain 3
dog(610424) ring finger and WD repeat domain 3
domestic cat(101089313) ring finger and WD repeat domain 3
Horse(100055114) ring finger and WD repeat domain 3
domestic guinea pig(100716272) ring finger and WD repeat domain 3
naked mole-rat(101714460) ring finger and WD repeat domain 3
cow(540072) ring finger and WD repeat domain 3
sheep(101116421) ring finger and WD repeat domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018124 Rosetta Predictions human pricing
XM_001075875 Rosetta Predictions rat pricing
XM_341690 Rosetta Predictions rat pricing
NM_146218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182002 predicted 2455
2 SASI_Hs01_00182003 predicted 1134
3 SASI_Hs01_00182004 predicted 2344
4 SASI_Hs01_00182005 predicted 693
5 SASI_Hs01_00182006 predicted 2512
6 SASI_Hs01_00182008 predicted 1606
7 SASI_Hs01_00182009 predicted 2359
8 SASI_Hs01_00182010 predicted 1209
9 SASI_Hs01_00182011 predicted 2384
10 SASI_Hs02_00351333 predicted 1048
11 SASI_Hs01_00182007 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351336 predicted 1719
2 SASI_Rn02_00351337 predicted 1484
3 SASI_Rn02_00351338 predicted 1508
4 SASI_Rn02_00351339 predicted 2233
5 SASI_Rn02_00351340 predicted 1524
6 SASI_Rn02_00351341 predicted 1332
7 SASI_Rn02_00351342 predicted 2301
8 SASI_Rn02_00351343 predicted 1732
9 SASI_Rn02_00351344 predicted 2406
10 SASI_Rn02_00351345 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393243 predicted 1724
2 SASI_Rn02_00393244 predicted 1484
3 SASI_Rn02_00393245 predicted 1501
4 SASI_Rn02_00393246 predicted 2230
5 SASI_Rn02_00393247 predicted 1524
6 SASI_Rn02_00393248 predicted 1339
7 SASI_Rn02_00393249 predicted 2308
8 SASI_Rn02_00393250 predicted 1732
9 SASI_Rn02_00393251 predicted 2403
10 SASI_Rn02_00393252 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341919 predicted 304
2 SASI_Mm01_00175605 predicted 1360
3 SASI_Mm01_00175606 predicted 607
4 SASI_Mm01_00175607 predicted 1995
5 SASI_Mm01_00175608 predicted 1085
6 SASI_Mm02_00341920 predicted 1601
7 SASI_Mm01_00175610 predicted 2165
8 SASI_Mm01_00175611 predicted 1702
9 SASI_Mm01_00175612 predicted 2197
10 SASI_Mm01_00175613 predicted 1194
11 SASI_Mm01_00175609 predicted 2406
12 SASI_Mm01_00175614 predicted 1476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146218
VALIDATED
RFWD3 MISSION shRNA Bacterial Glycerol Stock
ring finger and WD repeat domain 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-470s1c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146218.2-910s1c1
Sequence:CCGGGCACAATATGTTTGGAACAATCTCGAGATTGTTCCAAACATATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-4288s1c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-2297s1c1
Sequence:CCGGCCCATTTGAAACGAATCAGAACTCGAGTTCTGATTCGTTTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-1755s1c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-124s21c1
Sequence:CCGGGGACCATTAGAGGGTACTATACTCGAGTATAGTACCCTCTAATGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-465s21c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-1750s21c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-601s21c1
Sequence:CCGGGTGCCACATACACCACTATATCTCGAGATATAGTGGTGTATGTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146218.4-4283s21c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146218
VALIDATED
RFWD3 MISSION shRNA shRNA Plasmid DNA
ring finger and WD repeat domain 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-470s1c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146218.2-910s1c1
Sequence:CCGGGCACAATATGTTTGGAACAATCTCGAGATTGTTCCAAACATATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-4288s1c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-2297s1c1
Sequence:CCGGCCCATTTGAAACGAATCAGAACTCGAGTTCTGATTCGTTTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-1755s1c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-124s21c1
Sequence:CCGGGGACCATTAGAGGGTACTATACTCGAGTATAGTACCCTCTAATGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-465s21c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-1750s21c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-601s21c1
Sequence:CCGGGTGCCACATACACCACTATATCTCGAGATATAGTGGTGTATGTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146218.4-4283s21c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146218
VALIDATED
RFWD3 MISSION shRNA Lentiviral Transduction Particles
ring finger and WD repeat domain 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-470s1c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146218.2-910s1c1
Sequence:CCGGGCACAATATGTTTGGAACAATCTCGAGATTGTTCCAAACATATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-4288s1c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-2297s1c1
Sequence:CCGGCCCATTTGAAACGAATCAGAACTCGAGTTCTGATTCGTTTCAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146218.2-1755s1c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-124s21c1
Sequence:CCGGGGACCATTAGAGGGTACTATACTCGAGTATAGTACCCTCTAATGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-465s21c1
Sequence:CCGGGCTTCATAACATGCTGGAATTCTCGAGAATTCCAGCATGTTATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-1750s21c1
Sequence:CCGGCGGAACACAAACACCTATATTCTCGAGAATATAGGTGTTTGTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146218.4-601s21c1
Sequence:CCGGGTGCCACATACACCACTATATCTCGAGATATAGTGGTGTATGTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146218.4-4283s21c1
Sequence:CCGGGCAAGAAACTTCATCTCTAAACTCGAGTTTAGAGATGAAGTTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018124
VALIDATED
RFWD3 MISSION shRNA Bacterial Glycerol Stock
ring finger and WD repeat domain 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1030s1c1
Sequence:CCGGGCTTCCCTAGACAACACTATTCTCGAGAATAGTGTTGTCTAGGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018124.2-1164s1c1
Sequence:CCGGCAATGGTTCAATTCTGGTATACTCGAGTATACCAGAATTGAACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1720s1c1
Sequence:CCGGGTGTTGGACATCTGCCCATTTCTCGAGAAATGGGCAGATGTCCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2848s21c1
Sequence:CCGGCCATCGTCTTGGTACTGATTTCTCGAGAAATCAGTACCAAGACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1594s21c1
Sequence:CCGGAGATCCGTGGACTGGCGTTTACTCGAGTAAACGCCAGTCCACGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1106s21c1
Sequence:CCGGCAGTGACATTGTCGTCCTTTACTCGAGTAAAGGACGACAATGTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2618s21c1
Sequence:CCGGGAGTAATTGATGGGTACTTTACTCGAGTAAAGTACCCATCAATTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1689s21c1
Sequence:CCGGACCGTGGTCCAGACTTATAATCTCGAGATTATAAGTCTGGACCACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018124
VALIDATED
RFWD3 MISSION shRNA shRNA Plasmid DNA
ring finger and WD repeat domain 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1030s1c1
Sequence:CCGGGCTTCCCTAGACAACACTATTCTCGAGAATAGTGTTGTCTAGGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018124.2-1164s1c1
Sequence:CCGGCAATGGTTCAATTCTGGTATACTCGAGTATACCAGAATTGAACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1720s1c1
Sequence:CCGGGTGTTGGACATCTGCCCATTTCTCGAGAAATGGGCAGATGTCCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2848s21c1
Sequence:CCGGCCATCGTCTTGGTACTGATTTCTCGAGAAATCAGTACCAAGACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1594s21c1
Sequence:CCGGAGATCCGTGGACTGGCGTTTACTCGAGTAAACGCCAGTCCACGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1106s21c1
Sequence:CCGGCAGTGACATTGTCGTCCTTTACTCGAGTAAAGGACGACAATGTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2618s21c1
Sequence:CCGGGAGTAATTGATGGGTACTTTACTCGAGTAAAGTACCCATCAATTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1689s21c1
Sequence:CCGGACCGTGGTCCAGACTTATAATCTCGAGATTATAAGTCTGGACCACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018124
VALIDATED
RFWD3 MISSION shRNA Lentiviral Transduction Particles
ring finger and WD repeat domain 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1030s1c1
Sequence:CCGGGCTTCCCTAGACAACACTATTCTCGAGAATAGTGTTGTCTAGGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018124.2-1164s1c1
Sequence:CCGGCAATGGTTCAATTCTGGTATACTCGAGTATACCAGAATTGAACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018124.2-1720s1c1
Sequence:CCGGGTGTTGGACATCTGCCCATTTCTCGAGAAATGGGCAGATGTCCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2848s21c1
Sequence:CCGGCCATCGTCTTGGTACTGATTTCTCGAGAAATCAGTACCAAGACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1594s21c1
Sequence:CCGGAGATCCGTGGACTGGCGTTTACTCGAGTAAACGCCAGTCCACGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1106s21c1
Sequence:CCGGCAGTGACATTGTCGTCCTTTACTCGAGTAAAGGACGACAATGTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018124.3-2618s21c1
Sequence:CCGGGAGTAATTGATGGGTACTTTACTCGAGTAAAGTACCCATCAATTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018124.3-1689s21c1
Sequence:CCGGACCGTGGTCCAGACTTATAATCTCGAGATTATAAGTCTGGACCACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)