EMAIL THIS PAGE TO A FRIEND

RFX1

regulatory factor X, 1 (influences HLA class II expression)

131 Gene Product Result for
Synonyms: EFC RFX
UniProtKB ID: P22670
Gene ID:
Human(5989) Summary: This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X2, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with RFX family members X2, X3, and X5, but not with X4. This protein binds to the X-boxes of MHC class II genes and is essential for their expression. Also, it can bind to an inverted repeat that is required for expression of hepatitis B virus genes. [provided by RefSeq, Jul 2008]
Mouse(19724) regulatory factor X, 1 (influences HLA class II expression)
Rat(288906) regulatory factor X, 1 (influences HLA class II expression)
domestic cat(101096293) regulatory factor X, 1 (influences HLA class II expression)
dog(484908) regulatory factor X, 1 (influences HLA class II expression)
cow(789747) regulatory factor X, 1 (influences HLA class II expression)
sheep(101119391) regulatory factor X, 1 (influences HLA class II expression)
naked mole-rat(101703619) regulatory factor X, 1 (influences HLA class II expression)
domestic guinea pig(100736012) regulatory factor X, 1 (influences HLA class II expression)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002918 Rosetta Predictions human pricing
NM_001105944 Rosetta Predictions rat pricing
NM_009055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132659 predicted 869
2 SASI_Hs01_00132660 predicted 2135
3 SASI_Hs01_00132662 predicted 2064
4 SASI_Hs01_00132663 predicted 1675
5 SASI_Hs01_00132664 predicted 621
6 SASI_Hs02_00334745 predicted 2200
7 SASI_Hs01_00132665 predicted 1728
8 SASI_Hs01_00132666 predicted 2273
9 SASI_Hs01_00132667 predicted 2256
10 SASI_Hs01_00132668 predicted 2368
11 SASI_Hs01_00132661 predicted 2779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214082 predicted 2031
2 SASI_Rn02_00214083 predicted 836
3 SASI_Rn02_00214084 predicted 759
4 SASI_Rn02_00214085 predicted 3325
5 SASI_Rn02_00214086 predicted 2506
6 SASI_Rn02_00214087 predicted 757
7 SASI_Rn02_00214088 predicted 2027
8 SASI_Rn02_00214089 predicted 1682
9 SASI_Rn02_00214090 predicted 3060
10 SASI_Rn02_00214091 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150404 predicted 1594
2 SASI_Mm01_00150405 predicted 3198
3 SASI_Mm01_00150406 predicted 2214
4 SASI_Mm01_00150407 predicted 1590
5 SASI_Mm01_00150408 predicted 2817
6 SASI_Mm01_00150409 predicted 1278
7 SASI_Mm01_00150410 predicted 1454
8 SASI_Mm02_00315223 predicted 1009
9 SASI_Mm01_00150411 predicted 1671
10 SASI_Mm01_00150413 predicted 2258
11 SASI_Mm01_00150412 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009055
RFX1 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 1 (influences HLA class II expression)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3482s21c1
Sequence:CCGGTGCGGAACTGTTAACTTATTCCTCGAGGAATAAGTTAACAGTTCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009055.4-1652s21c1
Sequence:CCGGCAAGCTCATCCGCTCGGTATTCTCGAGAATACCGAGCGGATGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009055.2-3905s1c1
Sequence:CCGGCCGATTTCTCAGTGTCTTCAACTCGAGTTGAAGACACTGAGAAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2220s1c1
Sequence:CCGGGCACTGTGACAATGTGCTGTACTCGAGTACAGCACATTGTCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-1679s1c1
Sequence:CCGGGCAACTCTAAGTACCACTATTCTCGAGAATAGTGGTACTTAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2472s1c1
Sequence:CCGGGCAGAACACTGCACAGATCAACTCGAGTTGATCTGTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2040s1c1
Sequence:CCGGCGTCATGGTAAACCTGCAGTTCTCGAGAACTGCAGGTTTACCATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3600s21c1
Sequence:CCGGTGGTATTAAGTGCAATTAAAGCTCGAGCTTTAATTGCACTTAATACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009055
RFX1 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 1 (influences HLA class II expression)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3482s21c1
Sequence:CCGGTGCGGAACTGTTAACTTATTCCTCGAGGAATAAGTTAACAGTTCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009055.4-1652s21c1
Sequence:CCGGCAAGCTCATCCGCTCGGTATTCTCGAGAATACCGAGCGGATGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009055.2-3905s1c1
Sequence:CCGGCCGATTTCTCAGTGTCTTCAACTCGAGTTGAAGACACTGAGAAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2220s1c1
Sequence:CCGGGCACTGTGACAATGTGCTGTACTCGAGTACAGCACATTGTCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-1679s1c1
Sequence:CCGGGCAACTCTAAGTACCACTATTCTCGAGAATAGTGGTACTTAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2472s1c1
Sequence:CCGGGCAGAACACTGCACAGATCAACTCGAGTTGATCTGTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2040s1c1
Sequence:CCGGCGTCATGGTAAACCTGCAGTTCTCGAGAACTGCAGGTTTACCATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3600s21c1
Sequence:CCGGTGGTATTAAGTGCAATTAAAGCTCGAGCTTTAATTGCACTTAATACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009055
RFX1 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 1 (influences HLA class II expression)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3482s21c1
Sequence:CCGGTGCGGAACTGTTAACTTATTCCTCGAGGAATAAGTTAACAGTTCCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009055.4-1652s21c1
Sequence:CCGGCAAGCTCATCCGCTCGGTATTCTCGAGAATACCGAGCGGATGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009055.2-3905s1c1
Sequence:CCGGCCGATTTCTCAGTGTCTTCAACTCGAGTTGAAGACACTGAGAAATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2220s1c1
Sequence:CCGGGCACTGTGACAATGTGCTGTACTCGAGTACAGCACATTGTCACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-1679s1c1
Sequence:CCGGGCAACTCTAAGTACCACTATTCTCGAGAATAGTGGTACTTAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2472s1c1
Sequence:CCGGGCAGAACACTGCACAGATCAACTCGAGTTGATCTGTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009055.2-2040s1c1
Sequence:CCGGCGTCATGGTAAACCTGCAGTTCTCGAGAACTGCAGGTTTACCATGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009055.4-3600s21c1
Sequence:CCGGTGGTATTAAGTGCAATTAAAGCTCGAGCTTTAATTGCACTTAATACCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002918
VALIDATED
RFX1 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 1 (influences HLA class II expression)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2923s21c1
Sequence:CCGGAGTACATGTACTACCTGATCGCTCGAGCGATCAGGTAGTACATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-2357s21c1
Sequence:CCGGACCCAAGCGATCCGGAACTTTCTCGAGAAAGTTCCGGATCGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1751s21c1
Sequence:CCGGTACTATGGCCTGCGCATCAAGCTCGAGCTTGATGCGCAGGCCATAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1608s21c1
Sequence:CCGGCCCTCTACTGCCACTACTTACCTCGAGGTAAGTAGTGGCAGTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.4-3584s21c1
Sequence:CCGGTTATTCAGCTCGCTGGCTTTGCTCGAGCAAAGCCAGCGAGCTGAATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-1590s21c1
Sequence:CCGGCAGTGGCTCCTGGACAACTATCTCGAGATAGTTGTCCAGGAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2231s21c1
Sequence:CCGGTGTACATGACGAGGCCGAGAACTCGAGTTCTCGGCCTCGTCATGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1167s21c1
Sequence:CCGGGTTCCAGCACCTACTCCTATCCTCGAGGATAGGAGTAGGTGCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1320s1c1
Sequence:CCGGGCAGGCACCTACGTGATCCAACTCGAGTTGGATCACGTAGGTGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.3-3530s21c1
Sequence:CCGGCGTGCGAAACTGTTAACTTATCTCGAGATAAGTTAACAGTTTCGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-3873s1c1
Sequence:CCGGGCCTGTGAGATAGATGTTTATCTCGAGATAAACATCTATCTCACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1997s1c1
Sequence:CCGGGAAGACCTTCTGGAGGTACAACTCGAGTTGTACCTCCAGAAGGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-2639s1c1
Sequence:CCGGCCTCCTCAAGTGGTCCTTCTACTCGAGTAGAAGGACCACTTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-846s1c1
Sequence:CCGGGCCACTCCACAAGCGCCCAAACTCGAGTTTGGGCGCTTGTGGAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002918
VALIDATED
RFX1 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 1 (influences HLA class II expression)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2923s21c1
Sequence:CCGGAGTACATGTACTACCTGATCGCTCGAGCGATCAGGTAGTACATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-2357s21c1
Sequence:CCGGACCCAAGCGATCCGGAACTTTCTCGAGAAAGTTCCGGATCGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1751s21c1
Sequence:CCGGTACTATGGCCTGCGCATCAAGCTCGAGCTTGATGCGCAGGCCATAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1608s21c1
Sequence:CCGGCCCTCTACTGCCACTACTTACCTCGAGGTAAGTAGTGGCAGTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.4-3584s21c1
Sequence:CCGGTTATTCAGCTCGCTGGCTTTGCTCGAGCAAAGCCAGCGAGCTGAATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-1590s21c1
Sequence:CCGGCAGTGGCTCCTGGACAACTATCTCGAGATAGTTGTCCAGGAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2231s21c1
Sequence:CCGGTGTACATGACGAGGCCGAGAACTCGAGTTCTCGGCCTCGTCATGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1167s21c1
Sequence:CCGGGTTCCAGCACCTACTCCTATCCTCGAGGATAGGAGTAGGTGCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1320s1c1
Sequence:CCGGGCAGGCACCTACGTGATCCAACTCGAGTTGGATCACGTAGGTGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.3-3530s21c1
Sequence:CCGGCGTGCGAAACTGTTAACTTATCTCGAGATAAGTTAACAGTTTCGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-3873s1c1
Sequence:CCGGGCCTGTGAGATAGATGTTTATCTCGAGATAAACATCTATCTCACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1997s1c1
Sequence:CCGGGAAGACCTTCTGGAGGTACAACTCGAGTTGTACCTCCAGAAGGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-2639s1c1
Sequence:CCGGCCTCCTCAAGTGGTCCTTCTACTCGAGTAGAAGGACCACTTGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-846s1c1
Sequence:CCGGGCCACTCCACAAGCGCCCAAACTCGAGTTTGGGCGCTTGTGGAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002918
VALIDATED
RFX1 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 1 (influences HLA class II expression)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2923s21c1
Sequence:CCGGAGTACATGTACTACCTGATCGCTCGAGCGATCAGGTAGTACATGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-2357s21c1
Sequence:CCGGACCCAAGCGATCCGGAACTTTCTCGAGAAAGTTCCGGATCGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1751s21c1
Sequence:CCGGTACTATGGCCTGCGCATCAAGCTCGAGCTTGATGCGCAGGCCATAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1608s21c1
Sequence:CCGGCCCTCTACTGCCACTACTTACCTCGAGGTAAGTAGTGGCAGTAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.4-3584s21c1
Sequence:CCGGTTATTCAGCTCGCTGGCTTTGCTCGAGCAAAGCCAGCGAGCTGAATAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-1590s21c1
Sequence:CCGGCAGTGGCTCCTGGACAACTATCTCGAGATAGTTGTCCAGGAGCCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.4-2231s21c1
Sequence:CCGGTGTACATGACGAGGCCGAGAACTCGAGTTCTCGGCCTCGTCATGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002918.3-1167s21c1
Sequence:CCGGGTTCCAGCACCTACTCCTATCCTCGAGGATAGGAGTAGGTGCTGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1320s1c1
Sequence:CCGGGCAGGCACCTACGTGATCCAACTCGAGTTGGATCACGTAGGTGCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002918.3-3530s21c1
Sequence:CCGGCGTGCGAAACTGTTAACTTATCTCGAGATAAGTTAACAGTTTCGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-3873s1c1
Sequence:CCGGGCCTGTGAGATAGATGTTTATCTCGAGATAAACATCTATCTCACAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-1997s1c1
Sequence:CCGGGAAGACCTTCTGGAGGTACAACTCGAGTTGTACCTCCAGAAGGTCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002918.2-2639s1c1
Sequence:CCGGCCTCCTCAAGTGGTCCTTCTACTCGAGTAGAAGGACCACTTGAGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002918.2-846s1c1
Sequence:CCGGGCCACTCCACAAGCGCCCAAACTCGAGTTTGGGCGCTTGTGGAGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)