EMAIL THIS PAGE TO A FRIEND

RFX2

regulatory factor X, 2 (influences HLA class II expression)

56 Gene Product Result for
UniProtKB ID: P48378, A8K581, B3KNC4, Q6IQ44, Q8SNA2
Gene ID:
Human(5990) Summary: This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
Mouse(19725) regulatory factor X, 2 (influences HLA class II expression)
Rat(301121) regulatory factor X, 2 (influences HLA class II expression)
Zebrafish(503590) regulatory factor X, 2 (influences HLA class II expression)
chicken(420092) regulatory factor X, 2 (influences HLA class II expression)
domestic cat(101085185) regulatory factor X, 2 (influences HLA class II expression)
Horse(100060438) regulatory factor X, 2 (influences HLA class II expression)
dog(476733) regulatory factor X, 2 (influences HLA class II expression)
domestic guinea pig(100723402) regulatory factor X, 2 (influences HLA class II expression)
naked mole-rat(101703572) regulatory factor X, 2 (influences HLA class II expression)
Domestic Rabbit(100350548) regulatory factor X, 2 (influences HLA class II expression)
cow(534475) regulatory factor X, 2 (influences HLA class II expression)
sheep(101107090) regulatory factor X, 2 (influences HLA class II expression)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000635 Rosetta Predictions human pricing
NM_134433 Rosetta Predictions human pricing
NM_001106877 Rosetta Predictions rat pricing
NM_009056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058271 predicted 2372
2 SASI_Hs01_00058272 predicted 2388
3 SASI_Hs01_00058273 predicted 2137
4 SASI_Hs01_00058274 predicted 2157
5 SASI_Hs01_00058275 predicted 2411
6 SASI_Hs01_00058276 predicted 2409
7 SASI_Hs01_00058277 predicted 961
8 SASI_Hs01_00058278 predicted 409
9 SASI_Hs01_00058279 predicted 1615
10 SASI_Hs01_00058280 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244037 predicted 2297
2 SASI_Hs01_00244038 predicted 2318
3 SASI_Hs01_00244039 predicted 2068
4 SASI_Hs01_00244040 predicted 2080
5 SASI_Hs01_00244041 predicted 2338
6 SASI_Hs01_00244042 predicted 2329
7 SASI_Hs01_00244043 predicted 881
8 SASI_Hs01_00244044 predicted 409
9 SASI_Hs01_00244045 predicted 1544
10 SASI_Hs01_00244046 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223286 predicted 2672
2 SASI_Rn02_00223287 predicted 1187
3 SASI_Rn02_00223288 predicted 1340
4 SASI_Rn02_00223289 predicted 2293
5 SASI_Rn02_00223290 predicted 2379
6 SASI_Rn02_00223291 predicted 2561
7 SASI_Rn02_00223292 predicted 2684
8 SASI_Rn02_00223293 predicted 2610
9 SASI_Rn02_00223294 predicted 1348
10 SASI_Rn02_00223295 predicted 2289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124299 predicted 1578
2 SASI_Mm01_00124300 predicted 2237
3 SASI_Mm01_00124301 predicted 2330
4 SASI_Mm01_00124302 predicted 1254
5 SASI_Mm01_00124303 predicted 2267
6 SASI_Mm01_00124304 predicted 695
7 SASI_Mm01_00124305 predicted 1135
8 SASI_Mm01_00124306 predicted 735
9 SASI_Mm01_00124307 predicted 2237
10 SASI_Mm01_00124308 predicted 2249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000635
RFX2 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 2 (influences HLA class II expression)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-714s1c1
Sequence:CCGGCGAAGGAATCACATCACACAACTCGAGTTGTGTGATGTGATTCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1347s1c1
Sequence:CCGGGCTCTCCTTCTGGAACTCTAACTCGAGTTAGAGTTCCAGAAGGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000635.2-2407s1c1
Sequence:CCGGCCACCAAATTAGTGCCTCTTACTCGAGTAAGAGGCACTAATTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1320s1c1
Sequence:CCGGCCAGTTCCACTACATCGAGAACTCGAGTTCTCGATGTAGTGGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-2202s1c1
Sequence:CCGGGCTGCTCGACAAAGATGACATCTCGAGATGTCATCTTTGTCGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000635
RFX2 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 2 (influences HLA class II expression)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-714s1c1
Sequence:CCGGCGAAGGAATCACATCACACAACTCGAGTTGTGTGATGTGATTCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1347s1c1
Sequence:CCGGGCTCTCCTTCTGGAACTCTAACTCGAGTTAGAGTTCCAGAAGGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000635.2-2407s1c1
Sequence:CCGGCCACCAAATTAGTGCCTCTTACTCGAGTAAGAGGCACTAATTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1320s1c1
Sequence:CCGGCCAGTTCCACTACATCGAGAACTCGAGTTCTCGATGTAGTGGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-2202s1c1
Sequence:CCGGGCTGCTCGACAAAGATGACATCTCGAGATGTCATCTTTGTCGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000635
RFX2 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 2 (influences HLA class II expression)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-714s1c1
Sequence:CCGGCGAAGGAATCACATCACACAACTCGAGTTGTGTGATGTGATTCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1347s1c1
Sequence:CCGGGCTCTCCTTCTGGAACTCTAACTCGAGTTAGAGTTCCAGAAGGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000635.2-2407s1c1
Sequence:CCGGCCACCAAATTAGTGCCTCTTACTCGAGTAAGAGGCACTAATTTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-1320s1c1
Sequence:CCGGCCAGTTCCACTACATCGAGAACTCGAGTTCTCGATGTAGTGGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000635.2-2202s1c1
Sequence:CCGGGCTGCTCGACAAAGATGACATCTCGAGATGTCATCTTTGTCGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009056
RFX2 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 2 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009056.1-2332s1c1
Sequence:CCGGGCAACTAAGATGGTCACTCAACTCGAGTTGAGTGACCATCTTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-996s1c1
Sequence:CCGGCATCACCAGCAGTACATAGATCTCGAGATCTATGTACTGCTGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-713s1c1
Sequence:CCGGCGCATCCTTTGGCAAACTCATCTCGAGATGAGTTTGCCAAAGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-1283s1c1
Sequence:CCGGGAAGCTCATCTCTCTGTGTAACTCGAGTTACACAGAGAGATGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-782s1c1
Sequence:CCGGCAACTCAAAGTACCATTACTACTCGAGTAGTAATGGTACTTTGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009056
RFX2 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 2 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009056.1-2332s1c1
Sequence:CCGGGCAACTAAGATGGTCACTCAACTCGAGTTGAGTGACCATCTTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-996s1c1
Sequence:CCGGCATCACCAGCAGTACATAGATCTCGAGATCTATGTACTGCTGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-713s1c1
Sequence:CCGGCGCATCCTTTGGCAAACTCATCTCGAGATGAGTTTGCCAAAGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-1283s1c1
Sequence:CCGGGAAGCTCATCTCTCTGTGTAACTCGAGTTACACAGAGAGATGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-782s1c1
Sequence:CCGGCAACTCAAAGTACCATTACTACTCGAGTAGTAATGGTACTTTGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009056
RFX2 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 2 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009056.1-2332s1c1
Sequence:CCGGGCAACTAAGATGGTCACTCAACTCGAGTTGAGTGACCATCTTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-996s1c1
Sequence:CCGGCATCACCAGCAGTACATAGATCTCGAGATCTATGTACTGCTGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-713s1c1
Sequence:CCGGCGCATCCTTTGGCAAACTCATCTCGAGATGAGTTTGCCAAAGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-1283s1c1
Sequence:CCGGGAAGCTCATCTCTCTGTGTAACTCGAGTTACACAGAGAGATGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009056.1-782s1c1
Sequence:CCGGCAACTCAAAGTACCATTACTACTCGAGTAGTAATGGTACTTTGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)