EMAIL THIS PAGE TO A FRIEND

RFX4

regulatory factor X, 4 (influences HLA class II expression)

205 Gene Product Result for
Synonyms: NYD-SP10
Gene ID:
Human(5992) Summary: This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
Mouse(71137) regulatory factor X, 4 (influences HLA class II expression)
Rat(500818) regulatory factor X, 4 (influences HLA class II expression)
Zebrafish(403016) regulatory factor X, 4
chicken(418070) regulatory factor X, 4 (influences HLA class II expression)
Horse(100053854) regulatory factor X, 4 (influences HLA class II expression)
domestic cat(101087757) regulatory factor X, 4 (influences HLA class II expression)
dog(474529) regulatory factor X, 4 (influences HLA class II expression)
domestic guinea pig(100719732) regulatory factor X, 4 (influences HLA class II expression)
naked mole-rat(101724281) regulatory factor X, 4 (influences HLA class II expression)
Domestic Rabbit(100348222) regulatory factor X, 4 (influences HLA class II expression)
cow(533900) regulatory factor X, 4 (influences HLA class II expression)
sheep(101115697) regulatory factor X, 4 (influences HLA class II expression)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_125797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002920 Rosetta Predictions human pricing
NM_032491 Rosetta Predictions human pricing
NM_213594 Rosetta Predictions human pricing
XM_576205 Rosetta Predictions rat pricing
XR_009294 Rosetta Predictions rat pricing
NM_001024918 Rosetta Predictions mouse pricing
NM_027689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224403 predicted 779
2 SASI_Hs01_00224404 predicted 1073
3 SASI_Hs02_00334748 predicted 785
4 SASI_Hs01_00224405 predicted 1243
5 SASI_Hs01_00224406 predicted 746
6 SASI_Hs01_00224407 predicted 1523
7 SASI_Hs01_00224408 predicted 722
8 SASI_Hs02_00334749 predicted 719
9 SASI_Hs01_00224410 predicted 1489
10 SASI_Hs01_00224412 predicted 1493
11 SASI_Hs01_00224409 predicted 958
12 SASI_Hs01_00224411 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018144 predicted 472
2 SASI_Hs01_00018145 predicted 765
3 SASI_Hs02_00359958 predicted 477
4 SASI_Hs01_00018146 predicted 935
5 SASI_Hs01_00018147 predicted 435
6 SASI_Hs01_00018148 predicted 1221
7 SASI_Hs01_00018149 predicted 410
8 SASI_Hs02_00359959 predicted 407
9 SASI_Hs01_00018151 predicted 1180
10 SASI_Hs01_00018153 predicted 1183
11 SASI_Hs01_00018150 predicted 652
12 SASI_Hs01_00018152 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097708 predicted 716
2 SASI_Hs01_00097709 predicted 1012
3 SASI_Hs02_00374267 predicted 716
4 SASI_Hs01_00097710 predicted 1177
5 SASI_Hs01_00097711 predicted 677
6 SASI_Hs01_00097712 predicted 1458
7 SASI_Hs01_00097713 predicted 652
8 SASI_Hs02_00374268 predicted 647
9 SASI_Hs01_00097715 predicted 1420
10 SASI_Hs01_00097717 predicted 1426
11 SASI_Hs01_00097714 predicted 902
12 SASI_Hs01_00097716 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404847 predicted 2109
2 SASI_Rn02_00404848 predicted 1753
3 SASI_Rn02_00404849 predicted 2047
4 SASI_Rn02_00404850 predicted 1908
5 SASI_Rn02_00404851 predicted 3062
6 SASI_Rn02_00404852 predicted 1682
7 SASI_Rn02_00404853 predicted 2123
8 SASI_Rn02_00404854 predicted 3005
9 SASI_Rn02_00404855 predicted 2214
10 SASI_Rn02_00404856 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419317 predicted 806
2 SASI_Rn01_00135540 predicted 1032
3 SASI_Rn02_00419318 predicted 887
4 SASI_Rn02_00419319 predicted 990
5 SASI_Rn01_00135543 predicted 1059
6 SASI_Rn01_00135544 predicted 993
7 SASI_Rn02_00419320 predicted 773
8 SASI_Rn02_00419321 predicted 1059
9 SASI_Rn02_00419322 predicted 986
10 SASI_Rn01_00135547 predicted 930
11 SASI_Rn01_00135541 predicted 2082
12 SASI_Rn01_00135542 predicted 3277
13 SASI_Rn01_00135545 predicted 1323
14 SASI_Rn01_00135546 predicted 1529
15 SASI_Rn01_00135548 predicted 2995
16 SASI_Rn01_00135549 predicted 1957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095619 predicted 1073
2 SASI_Mm01_00095620 predicted 1009
3 SASI_Mm01_00095622 predicted 2137
4 SASI_Mm01_00095623 predicted 1076
5 SASI_Mm01_00095624 predicted 2386
6 SASI_Mm01_00095625 predicted 1544
7 SASI_Mm02_00287739 predicted 1388
8 SASI_Mm01_00095626 predicted 2129
9 SASI_Mm01_00095627 predicted 1338
10 SASI_Mm01_00095628 predicted 2112
11 SASI_Mm01_00095621 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086189 predicted 406
2 SASI_Mm01_00086190 predicted 348
3 SASI_Mm01_00086192 predicted 1465
4 SASI_Mm01_00086193 predicted 410
5 SASI_Mm01_00086194 predicted 1722
6 SASI_Mm01_00086195 predicted 874
7 SASI_Mm02_00332578 predicted 714
8 SASI_Mm01_00086196 predicted 1461
9 SASI_Mm01_00086197 predicted 675
10 SASI_Mm01_00086198 predicted 1448
11 SASI_Mm01_00086191 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002920
RFX4 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 4 (influences HLA class II expression)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1517s21c1
Sequence:CCGGACTACGTGCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGCACGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1489s21c1
Sequence:CCGGTTTCACCTAATTCACTTAATGCTCGAGCATTAAGTGAATTAGGTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-534s21c1
Sequence:CCGGGAAAGAAAGCTCCCAATATTACTCGAGTAATATTGGGAGCTTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-498s21c1
Sequence:CCGGAGGACAGTCAAAGTACCATTACTCGAGTAATGGTACTTTGACTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-390s1c1
Sequence:CCGGCCTGGATTTCTGCGAGAAGAACTCGAGTTCTTCTCGCAGAAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1252s1c1
Sequence:CCGGCGGAAACTCATCACCCAATTACTCGAGTAATTGGGTGATGAGTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002920.3-1833s1c1
Sequence:CCGGGCAACATAGTGAGACTTCATTCTCGAGAATGAAGTCTCACTATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-676s1c1
Sequence:CCGGCCCAATGTCAAAGATCTAAATCTCGAGATTTAGATCTTTGACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1082s1c1
Sequence:CCGGCCCAAATTCTGAGACGGCAAACTCGAGTTTGCCGTCTCAGAATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002920
RFX4 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 4 (influences HLA class II expression)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1517s21c1
Sequence:CCGGACTACGTGCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGCACGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1489s21c1
Sequence:CCGGTTTCACCTAATTCACTTAATGCTCGAGCATTAAGTGAATTAGGTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-534s21c1
Sequence:CCGGGAAAGAAAGCTCCCAATATTACTCGAGTAATATTGGGAGCTTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-498s21c1
Sequence:CCGGAGGACAGTCAAAGTACCATTACTCGAGTAATGGTACTTTGACTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-390s1c1
Sequence:CCGGCCTGGATTTCTGCGAGAAGAACTCGAGTTCTTCTCGCAGAAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1252s1c1
Sequence:CCGGCGGAAACTCATCACCCAATTACTCGAGTAATTGGGTGATGAGTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002920.3-1833s1c1
Sequence:CCGGGCAACATAGTGAGACTTCATTCTCGAGAATGAAGTCTCACTATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-676s1c1
Sequence:CCGGCCCAATGTCAAAGATCTAAATCTCGAGATTTAGATCTTTGACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1082s1c1
Sequence:CCGGCCCAAATTCTGAGACGGCAAACTCGAGTTTGCCGTCTCAGAATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002920
RFX4 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 4 (influences HLA class II expression)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1517s21c1
Sequence:CCGGACTACGTGCTCTACCTGTTAGCTCGAGCTAACAGGTAGAGCACGTAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-1489s21c1
Sequence:CCGGTTTCACCTAATTCACTTAATGCTCGAGCATTAAGTGAATTAGGTGAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-534s21c1
Sequence:CCGGGAAAGAAAGCTCCCAATATTACTCGAGTAATATTGGGAGCTTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002920.3-498s21c1
Sequence:CCGGAGGACAGTCAAAGTACCATTACTCGAGTAATGGTACTTTGACTGTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-390s1c1
Sequence:CCGGCCTGGATTTCTGCGAGAAGAACTCGAGTTCTTCTCGCAGAAATCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1252s1c1
Sequence:CCGGCGGAAACTCATCACCCAATTACTCGAGTAATTGGGTGATGAGTTTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002920.3-1833s1c1
Sequence:CCGGGCAACATAGTGAGACTTCATTCTCGAGAATGAAGTCTCACTATGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-676s1c1
Sequence:CCGGCCCAATGTCAAAGATCTAAATCTCGAGATTTAGATCTTTGACATTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002920.3-1082s1c1
Sequence:CCGGCCCAAATTCTGAGACGGCAAACTCGAGTTTGCCGTCTCAGAATTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027689
RFX4 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 4 (influences HLA class II expression)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000422213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-1274s21c1
Sequence:CCGGCCTTCACCTGGTCCATCATTTCTCGAGAAATGATGGACCAGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-299s21c1
Sequence:CCGGCCAAACGTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGACGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027689.3-2354s21c1
Sequence:CCGGTGTTCTTGGACGGGCACATAACTCGAGTTATGTGCCCGTCCAAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027689
RFX4 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 4 (influences HLA class II expression)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000422213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-1274s21c1
Sequence:CCGGCCTTCACCTGGTCCATCATTTCTCGAGAAATGATGGACCAGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-299s21c1
Sequence:CCGGCCAAACGTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGACGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027689.3-2354s21c1
Sequence:CCGGTGTTCTTGGACGGGCACATAACTCGAGTTATGTGCCCGTCCAAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027689
RFX4 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 4 (influences HLA class II expression)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000422213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-1274s21c1
Sequence:CCGGCCTTCACCTGGTCCATCATTTCTCGAGAAATGATGGACCAGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027689.3-299s21c1
Sequence:CCGGCCAAACGTCAAAGACCTAAATCTCGAGATTTAGGTCTTTGACGTTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027689.3-2354s21c1
Sequence:CCGGTGTTCTTGGACGGGCACATAACTCGAGTTATGTGCCCGTCCAAGAACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125797
RFX4 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 4 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-943s1c1
Sequence:CCGGCCAACTTTGATGAGGTTCAAACTCGAGTTTGAACCTCATCAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1237s1c1
Sequence:CCGGCCCAAATCCTAAGGAGGCAAACTCGAGTTTGCCTCCTTAGGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-2362s1c1
Sequence:CCGGCCACGAGGTATGGAAACTCTACTCGAGTAGAGTTTCCATACCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1945s1c1
Sequence:CCGGCGCTAACATATACAGTAACAACTCGAGTTGTTACTGTATATGTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-545s1c1
Sequence:CCGGCCTGGATTTCTGTGAGAAGAACTCGAGTTCTTCTCACAGAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125797
RFX4 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 4 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-943s1c1
Sequence:CCGGCCAACTTTGATGAGGTTCAAACTCGAGTTTGAACCTCATCAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1237s1c1
Sequence:CCGGCCCAAATCCTAAGGAGGCAAACTCGAGTTTGCCTCCTTAGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-2362s1c1
Sequence:CCGGCCACGAGGTATGGAAACTCTACTCGAGTAGAGTTTCCATACCTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1945s1c1
Sequence:CCGGCGCTAACATATACAGTAACAACTCGAGTTGTTACTGTATATGTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-545s1c1
Sequence:CCGGCCTGGATTTCTGTGAGAAGAACTCGAGTTCTTCTCACAGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125797
RFX4 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 4 (influences HLA class II expression)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-943s1c1
Sequence:CCGGCCAACTTTGATGAGGTTCAAACTCGAGTTTGAACCTCATCAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1237s1c1
Sequence:CCGGCCCAAATCCTAAGGAGGCAAACTCGAGTTTGCCTCCTTAGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-2362s1c1
Sequence:CCGGCCACGAGGTATGGAAACTCTACTCGAGTAGAGTTTCCATACCTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-1945s1c1
Sequence:CCGGCGCTAACATATACAGTAACAACTCGAGTTGTTACTGTATATGTTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125797.4-545s1c1
Sequence:CCGGCCTGGATTTCTGTGAGAAGAACTCGAGTTCTTCTCACAGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)