EMAIL THIS PAGE TO A FRIEND

RFX6

regulatory factor X, 6

96 Gene Product Result for
Synonyms: MTFS RFXDC1 dJ955L16.1
UniProtKB ID: Q8HWS3, Q5T6B3
Gene ID:
Human(222546) Summary: The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
Mouse(320995) regulatory factor X, 6
Rat(294395) regulatory factor X, 6
Zebrafish(556925) regulatory factor X, 6
dog(484096) regulatory factor X, 6
domestic cat(101096653) regulatory factor X, 6
chicken(421737) regulatory factor X, 6
domestic guinea pig(100724529) regulatory factor X, 6
naked mole-rat(101702134) regulatory factor X, 6
cow(524074) regulatory factor X, 6
sheep(101103984) regulatory factor X, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173560 Rosetta Predictions human pricing
NM_001106388 Rosetta Predictions rat pricing
NM_177306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042372 predicted 1260
2 SASI_Hs01_00042373 predicted 664
3 SASI_Hs01_00042375 predicted 2523
4 SASI_Hs01_00042376 predicted 1274
5 SASI_Hs01_00042378 predicted 2248
6 SASI_Hs01_00042379 predicted 1633
7 SASI_Hs02_00368383 predicted 2260
8 SASI_Hs02_00368384 predicted 836
9 SASI_Hs01_00042380 predicted 1778
10 SASI_Hs01_00042381 predicted 476
11 SASI_Hs01_00042374 predicted 1014
12 SASI_Hs01_00042377 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218478 predicted 2082
2 SASI_Rn02_00218479 predicted 2066
3 SASI_Rn02_00218480 predicted 2118
4 SASI_Rn02_00218481 predicted 2408
5 SASI_Rn02_00218482 predicted 478
6 SASI_Rn02_00218483 predicted 2469
7 SASI_Rn02_00218484 predicted 635
8 SASI_Rn02_00218485 predicted 939
9 SASI_Rn02_00218486 predicted 1531
10 SASI_Rn02_00218487 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181919 predicted 2557
2 SASI_Mm02_00347382 predicted 511
3 SASI_Mm01_00181920 predicted 2177
4 SASI_Mm01_00181921 predicted 631
5 SASI_Mm01_00181922 predicted 1818
6 SASI_Mm01_00181923 predicted 1404
7 SASI_Mm01_00181924 predicted 1338
8 SASI_Mm01_00181925 predicted 2041
9 SASI_Mm01_00181926 predicted 1777
10 SASI_Mm01_00181928 predicted 1591
11 SASI_Mm01_00181927 predicted 1565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173560
RFX6 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-839s21c1
Sequence:CCGGACAAGGTTGATACGCTCATAACTCGAGTTATGAGCGTATCAACCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1635s21c1
Sequence:CCGGTCGAATGCTTCTCGATGAATACTCGAGTATTCATCGAGAAGCATTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1265s21c1
Sequence:CCGGTTGACCAGCATGTCGTTAATTCTCGAGAATTAACGACATGCTGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1698s1c1
Sequence:CCGGGCAGGAGTTACAGAATTTATTCTCGAGAATAAATTCTGTAACTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-291s1c1
Sequence:CCGGGCACTTAAACAATGGTAACTTCTCGAGAAGTTACCATTGTTTAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-2711s1c1
Sequence:CCGGCCCAATGTATGTATGGAACTTCTCGAGAAGTTCCATACATACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1584s1c1
Sequence:CCGGGCATAATCTCACCTTGAACAACTCGAGTTGTTCAAGGTGAGATTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-675s1c1
Sequence:CCGGCCACTCCGTTTATTCTGGAAACTCGAGTTTCCAGAATAAACGGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173560
RFX6 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-839s21c1
Sequence:CCGGACAAGGTTGATACGCTCATAACTCGAGTTATGAGCGTATCAACCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1635s21c1
Sequence:CCGGTCGAATGCTTCTCGATGAATACTCGAGTATTCATCGAGAAGCATTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1265s21c1
Sequence:CCGGTTGACCAGCATGTCGTTAATTCTCGAGAATTAACGACATGCTGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1698s1c1
Sequence:CCGGGCAGGAGTTACAGAATTTATTCTCGAGAATAAATTCTGTAACTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-291s1c1
Sequence:CCGGGCACTTAAACAATGGTAACTTCTCGAGAAGTTACCATTGTTTAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-2711s1c1
Sequence:CCGGCCCAATGTATGTATGGAACTTCTCGAGAAGTTCCATACATACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1584s1c1
Sequence:CCGGGCATAATCTCACCTTGAACAACTCGAGTTGTTCAAGGTGAGATTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-675s1c1
Sequence:CCGGCCACTCCGTTTATTCTGGAAACTCGAGTTTCCAGAATAAACGGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173560
RFX6 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-839s21c1
Sequence:CCGGACAAGGTTGATACGCTCATAACTCGAGTTATGAGCGTATCAACCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1635s21c1
Sequence:CCGGTCGAATGCTTCTCGATGAATACTCGAGTATTCATCGAGAAGCATTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173560.2-1265s21c1
Sequence:CCGGTTGACCAGCATGTCGTTAATTCTCGAGAATTAACGACATGCTGGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1698s1c1
Sequence:CCGGGCAGGAGTTACAGAATTTATTCTCGAGAATAAATTCTGTAACTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-291s1c1
Sequence:CCGGGCACTTAAACAATGGTAACTTCTCGAGAAGTTACCATTGTTTAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-2711s1c1
Sequence:CCGGCCCAATGTATGTATGGAACTTCTCGAGAAGTTCCATACATACATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-1584s1c1
Sequence:CCGGGCATAATCTCACCTTGAACAACTCGAGTTGTTCAAGGTGAGATTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173560.1-675s1c1
Sequence:CCGGCCACTCCGTTTATTCTGGAAACTCGAGTTTCCAGAATAAACGGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177306
RFX6 MISSION shRNA Bacterial Glycerol Stock
regulatory factor X, 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1908s21c1
Sequence:CCGGTGTGCTGGGTCTCCATATAATCTCGAGATTATATGGAGACCCAGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-2419s21c1
Sequence:CCGGCACCCATCAACACCGTGTTTACTCGAGTAAACACGGTGTTGATGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1397s21c1
Sequence:CCGGCTTTCTGGCCAACCGAAATAACTCGAGTTATTTCGGTTGGCCAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177306.2-2776s1c1
Sequence:CCGGCCTCCCTCTTTGGTTTCTAAACTCGAGTTTAGAAACCAAAGAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1200s1c1
Sequence:CCGGGCATAATCTTACCTTGAACAACTCGAGTTGTTCAAGGTAAGATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1194s1c1
Sequence:CCGGCGTGATGCATAATCTTACCTTCTCGAGAAGGTAAGATTATGCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-2327s1c1
Sequence:CCGGCCCAGTGTATGTATGGAACTTCTCGAGAAGTTCCATACATACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-694s1c1
Sequence:CCGGCCTGAAAGTTTGTTAGCAGATCTCGAGATCTGCTAACAAACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177306
RFX6 MISSION shRNA shRNA Plasmid DNA
regulatory factor X, 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1908s21c1
Sequence:CCGGTGTGCTGGGTCTCCATATAATCTCGAGATTATATGGAGACCCAGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-2419s21c1
Sequence:CCGGCACCCATCAACACCGTGTTTACTCGAGTAAACACGGTGTTGATGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1397s21c1
Sequence:CCGGCTTTCTGGCCAACCGAAATAACTCGAGTTATTTCGGTTGGCCAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177306.2-2776s1c1
Sequence:CCGGCCTCCCTCTTTGGTTTCTAAACTCGAGTTTAGAAACCAAAGAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1200s1c1
Sequence:CCGGGCATAATCTTACCTTGAACAACTCGAGTTGTTCAAGGTAAGATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1194s1c1
Sequence:CCGGCGTGATGCATAATCTTACCTTCTCGAGAAGGTAAGATTATGCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-2327s1c1
Sequence:CCGGCCCAGTGTATGTATGGAACTTCTCGAGAAGTTCCATACATACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-694s1c1
Sequence:CCGGCCTGAAAGTTTGTTAGCAGATCTCGAGATCTGCTAACAAACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177306
RFX6 MISSION shRNA Lentiviral Transduction Particles
regulatory factor X, 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1908s21c1
Sequence:CCGGTGTGCTGGGTCTCCATATAATCTCGAGATTATATGGAGACCCAGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-2419s21c1
Sequence:CCGGCACCCATCAACACCGTGTTTACTCGAGTAAACACGGTGTTGATGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177306.3-1397s21c1
Sequence:CCGGCTTTCTGGCCAACCGAAATAACTCGAGTTATTTCGGTTGGCCAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177306.2-2776s1c1
Sequence:CCGGCCTCCCTCTTTGGTTTCTAAACTCGAGTTTAGAAACCAAAGAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1200s1c1
Sequence:CCGGGCATAATCTTACCTTGAACAACTCGAGTTGTTCAAGGTAAGATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-1194s1c1
Sequence:CCGGCGTGATGCATAATCTTACCTTCTCGAGAAGGTAAGATTATGCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-2327s1c1
Sequence:CCGGCCCAGTGTATGTATGGAACTTCTCGAGAAGTTCCATACATACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177306.2-694s1c1
Sequence:CCGGCCTGAAAGTTTGTTAGCAGATCTCGAGATCTGCTAACAAACTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)