EMAIL THIS PAGE TO A FRIEND

RFX8

RFX family member 8, lacking RFX DNA binding domain

52 Gene Product Result for
UniProtKB ID: Q6ZV50, B4DQ32
Gene ID:
Mouse(619289) regulatory factor X 8
Rat(501127) RFX family member 8, lacking RFX DNA binding domain
chicken(418713) regulatory factor X, 8
Horse(100058955) RFX gene family member 8, lacking RFX DNA binding domain
domestic cat(101081720) RFX gene family member 8, lacking RFX DNA binding domain
dog(100683612) RFX gene family member 8, lacking RFX DNA binding domain
domestic guinea pig(100723372) RFX family member 8, lacking RFX DNA binding domain
Domestic Rabbit(100344807) RFX gene family member 8, lacking RFX DNA binding domain
naked mole-rat(101720388) RFX family member 8, lacking RFX DNA binding domain
cow(100138955) RFX family member 8, lacking RFX DNA binding domain
sheep(101110048) RFX family member 8, lacking RFX DNA binding domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001478116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001478116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001478116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170501 MISSION® esiRNA esiRNA targeting mouse Rfx8 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001058869 Rosetta Predictions rat pricing
XM_576547 Rosetta Predictions rat pricing
XM_001478116 Rosetta Predictions mouse pricing
XM_890488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291112 predicted 728
2 SASI_Rn02_00291113 predicted 1110
3 SASI_Rn02_00291114 predicted 294
4 SASI_Rn02_00291115 predicted 585
5 SASI_Rn02_00291116 predicted 645
6 SASI_Rn02_00291117 predicted 1547
7 SASI_Rn02_00291118 predicted 1718
8 SASI_Rn02_00291119 predicted 1221
9 SASI_Rn02_00291120 predicted 1639
10 SASI_Rn02_00291121 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405509 predicted 1144
2 SASI_Rn02_00405510 predicted 1119
3 SASI_Rn02_00405511 predicted 1121
4 SASI_Rn02_00405512 predicted 1139
5 SASI_Rn02_00405513 predicted 1077
6 SASI_Rn02_00405514 predicted 1147
7 SASI_Rn02_00405515 predicted 1145
8 SASI_Rn02_00405516 predicted 1110
9 SASI_Rn02_00405517 predicted 1085
10 SASI_Rn02_00405518 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00400442 predicted 415
2 SASI_Mm02_00400443 predicted 333
3 SASI_Mm02_00400444 predicted 327
4 SASI_Mm02_00400445 predicted 408
5 SASI_Mm02_00400446 predicted 435
6 SASI_Mm02_00400447 predicted 399
7 SASI_Mm02_00400448 predicted 235
8 SASI_Mm02_00400449 predicted 439
9 SASI_Mm02_00400450 predicted 230
10 SASI_Mm02_00400451 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283633 predicted 1109
2 SASI_Mm01_00283634 predicted 537
3 SASI_Mm01_00283635 predicted 645
4 SASI_Mm01_00283637 predicted 207
5 SASI_Mm01_00283638 predicted 1155
6 SASI_Mm01_00283639 predicted 383
7 SASI_Mm01_00283640 predicted 236
8 SASI_Mm01_00283641 predicted 723
9 SASI_Mm02_00428938 predicted 723
10 SASI_Mm01_00283642 predicted 582
11 SASI_Mm01_00283636 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001478116
RFX8 MISSION shRNA Bacterial Glycerol Stock
RFX family member 8, lacking RFX DNA binding domain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-46s21c1
Sequence:CCGGCATCTGCTGCTCTTGGAATATCTCGAGATATTCCAAGAGCAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-440s21c1
Sequence:GTACCGGAGAGGTTTGTGATCCACATATCTCGAGATATGTGGATCACAAACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-205s21c1
Sequence:CCGGTCGGAATGTGCAAGCCGGAATCTCGAGATTCCGGCTTGCACATTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-336s21c1
Sequence:CCGGCAATAAGCTTGTCCAGGTATTCTCGAGAATACCTGGACAAGCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-404s21c1
Sequence:CCGGTGGGACAAGAGGCCCTCATAACTCGAGTTATGAGGGCCTCTTGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001478116
RFX8 MISSION shRNA shRNA Plasmid DNA
RFX family member 8, lacking RFX DNA binding domain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-46s21c1
Sequence:CCGGCATCTGCTGCTCTTGGAATATCTCGAGATATTCCAAGAGCAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-440s21c1
Sequence:GTACCGGAGAGGTTTGTGATCCACATATCTCGAGATATGTGGATCACAAACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-205s21c1
Sequence:CCGGTCGGAATGTGCAAGCCGGAATCTCGAGATTCCGGCTTGCACATTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-336s21c1
Sequence:CCGGCAATAAGCTTGTCCAGGTATTCTCGAGAATACCTGGACAAGCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-404s21c1
Sequence:CCGGTGGGACAAGAGGCCCTCATAACTCGAGTTATGAGGGCCTCTTGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001478116
RFX8 MISSION shRNA Lentiviral Transduction Particles
RFX family member 8, lacking RFX DNA binding domain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-46s21c1
Sequence:CCGGCATCTGCTGCTCTTGGAATATCTCGAGATATTCCAAGAGCAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-440s21c1
Sequence:GTACCGGAGAGGTTTGTGATCCACATATCTCGAGATATGTGGATCACAAACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-205s21c1
Sequence:CCGGTCGGAATGTGCAAGCCGGAATCTCGAGATTCCGGCTTGCACATTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-336s21c1
Sequence:CCGGCAATAAGCTTGTCCAGGTATTCTCGAGAATACCTGGACAAGCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001478116.1-404s21c1
Sequence:CCGGTGGGACAAGAGGCCCTCATAACTCGAGTTATGAGGGCCTCTTGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)