EMAIL THIS PAGE TO A FRIEND

RFXANK

regulatory factor X-associated ankyrin-containing protein

97 Gene Product Result for
Synonyms: ANKRA1 BLS F14150_1 RFX-B
UniProtKB ID: O14593, O95839, Q6FGA8
Gene ID:
Human(8625) Summary: Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Mouse(19727) regulatory factor X-associated ankyrin-containing protein
Rat(306353) regulatory factor X-associated ankyrin-containing protein
cow(100125917) regulatory factor X-associated ankyrin-containing protein
sheep(101105568) regulatory factor X-associated ankyrin-containing protein
naked mole-rat(101712628) regulatory factor X-associated ankyrin-containing protein
domestic guinea pig(100716895) regulatory factor X-associated ankyrin-containing protein
Zebrafish(100170804) regulatory factor X-associated ankyrin-containing protein
domestic cat(101098525) regulatory factor X-associated ankyrin-containing protein
dog(476662) regulatory factor X-associated ankyrin-containing protein
chicken(426623) regulatory factor X-associated ankyrin-containing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003721 Rosetta Predictions human pricing
NM_134440 Rosetta Predictions human pricing
NM_001013136 Rosetta Predictions rat pricing
NM_001025589 Rosetta Predictions mouse pricing
NM_011266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213668 predicted 1139
2 SASI_Hs01_00213670 predicted 1041
3 SASI_Hs01_00213672 predicted 1044
4 SASI_Hs01_00213673 predicted 1097
5 SASI_Hs01_00213674 predicted 1190
6 SASI_Hs01_00213675 predicted 1095
7 SASI_Hs02_00336152 predicted 1184
8 SASI_Hs02_00336153 predicted 1196
9 SASI_Hs01_00213677 predicted 1208
10 SASI_Hs02_00336154 predicted 1042
11 SASI_Hs01_00213669 predicted 1048
12 SASI_Hs01_00213671 predicted 1203
13 SASI_Hs01_00213676 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198539 predicted 1064
2 SASI_Hs01_00198541 predicted 972
3 SASI_Hs01_00198543 predicted 976
4 SASI_Hs01_00198544 predicted 1028
5 SASI_Hs01_00198545 predicted 1119
6 SASI_Hs01_00198546 predicted 1021
7 SASI_Hs02_00363325 predicted 1119
8 SASI_Hs02_00363326 predicted 1128
9 SASI_Hs01_00198548 predicted 1132
10 SASI_Hs02_00363327 predicted 967
11 SASI_Hs01_00198540 predicted 982
12 SASI_Hs01_00198542 predicted 1140
13 SASI_Hs01_00198547 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105018 predicted 634
2 SASI_Rn01_00105020 predicted 628
3 SASI_Rn01_00105021 predicted 1082
4 SASI_Rn02_00200859 predicted 617
5 SASI_Rn01_00105022 predicted 837
6 SASI_Rn01_00105023 predicted 949
7 SASI_Rn01_00105024 predicted 961
8 SASI_Rn01_00105025 predicted 589
9 SASI_Rn01_00105027 predicted 377
10 SASI_Rn02_00200860 predicted 651
11 SASI_Rn01_00105019 predicted 550
12 SASI_Rn01_00105026 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287944 predicted 1157
2 SASI_Mm02_00287945 predicted 1009
3 SASI_Mm02_00287946 predicted 300
4 SASI_Mm02_00287947 predicted 343
5 SASI_Mm02_00287948 predicted 976
6 SASI_Mm02_00287949 predicted 890
7 SASI_Mm02_00287950 predicted 313
8 SASI_Mm02_00287951 predicted 394
9 SASI_Mm02_00287952 predicted 1019
10 SASI_Mm02_00287953 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320276 predicted 1178
2 SASI_Mm02_00320277 predicted 1040
3 SASI_Mm02_00320278 predicted 304
4 SASI_Mm02_00320279 predicted 341
5 SASI_Mm02_00320280 predicted 1006
6 SASI_Mm02_00320281 predicted 915
7 SASI_Mm02_00320282 predicted 317
8 SASI_Mm02_00320283 predicted 386
9 SASI_Mm02_00320284 predicted 1041
10 SASI_Mm02_00320285 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003721
VALIDATED
RFXANK MISSION shRNA Bacterial Glycerol Stock
regulatory factor X-associated ankyrin-containing protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-614s1c1
Sequence:CCGGACTGTGGTCCTCAGTCTCTTTCTCGAGAAAGAGACTGAGGACCACAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-841s1c1
Sequence:CCGGAGGTGACAACCTCGTCAACAACTCGAGTTGTTGACGAGGTTGTCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-896s1c1
Sequence:CCGGGCCTCCGCCTTTGGAGAGATTCTCGAGAATCTCTCCAAAGGCGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1051s1c1
Sequence:CCGGCATCAACATCTATGATTGGAACTCGAGTTCCAATCATAGATGTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1046s1c1
Sequence:CCGGGTGGACATCAACATCTATGATCTCGAGATCATAGATGTTGATGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1044s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-615s21c1
Sequence:CCGGCTGTGGTCCTCAGTCTCTTTCCTCGAGGAAAGAGACTGAGGACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-822s21c1
Sequence:CCGGTGAAGGAGCATTTGCGGAAAGCTCGAGCTTTCCGCAAATGCTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1105s21c1
Sequence:CCGGGAACCACGTGAAATGCGTTGACTCGAGTCAACGCATTTCACGTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-901s21c1
Sequence:CCGGCGCCTTTGGAGAGATTGAGACCTCGAGGTCTCAATCTCTCCAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003721
VALIDATED
RFXANK MISSION shRNA shRNA Plasmid DNA
regulatory factor X-associated ankyrin-containing protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-614s1c1
Sequence:CCGGACTGTGGTCCTCAGTCTCTTTCTCGAGAAAGAGACTGAGGACCACAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-841s1c1
Sequence:CCGGAGGTGACAACCTCGTCAACAACTCGAGTTGTTGACGAGGTTGTCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-896s1c1
Sequence:CCGGGCCTCCGCCTTTGGAGAGATTCTCGAGAATCTCTCCAAAGGCGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1051s1c1
Sequence:CCGGCATCAACATCTATGATTGGAACTCGAGTTCCAATCATAGATGTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1046s1c1
Sequence:CCGGGTGGACATCAACATCTATGATCTCGAGATCATAGATGTTGATGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1044s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-615s21c1
Sequence:CCGGCTGTGGTCCTCAGTCTCTTTCCTCGAGGAAAGAGACTGAGGACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-822s21c1
Sequence:CCGGTGAAGGAGCATTTGCGGAAAGCTCGAGCTTTCCGCAAATGCTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1105s21c1
Sequence:CCGGGAACCACGTGAAATGCGTTGACTCGAGTCAACGCATTTCACGTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-901s21c1
Sequence:CCGGCGCCTTTGGAGAGATTGAGACCTCGAGGTCTCAATCTCTCCAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003721
VALIDATED
RFXANK MISSION shRNA Lentiviral Transduction Particles
regulatory factor X-associated ankyrin-containing protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-614s1c1
Sequence:CCGGACTGTGGTCCTCAGTCTCTTTCTCGAGAAAGAGACTGAGGACCACAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-841s1c1
Sequence:CCGGAGGTGACAACCTCGTCAACAACTCGAGTTGTTGACGAGGTTGTCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-896s1c1
Sequence:CCGGGCCTCCGCCTTTGGAGAGATTCTCGAGAATCTCTCCAAAGGCGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1051s1c1
Sequence:CCGGCATCAACATCTATGATTGGAACTCGAGTTCCAATCATAGATGTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003721.2-1046s1c1
Sequence:CCGGGTGGACATCAACATCTATGATCTCGAGATCATAGATGTTGATGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1044s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-615s21c1
Sequence:CCGGCTGTGGTCCTCAGTCTCTTTCCTCGAGGAAAGAGACTGAGGACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-822s21c1
Sequence:CCGGTGAAGGAGCATTTGCGGAAAGCTCGAGCTTTCCGCAAATGCTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-1105s21c1
Sequence:CCGGGAACCACGTGAAATGCGTTGACTCGAGTCAACGCATTTCACGTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003721.2-901s21c1
Sequence:CCGGCGCCTTTGGAGAGATTGAGACCTCGAGGTCTCAATCTCTCCAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011266
VALIDATED
RFXANK MISSION shRNA Bacterial Glycerol Stock
regulatory factor X-associated ankyrin-containing protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-703s1c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011266.2-589s1c1
Sequence:CCGGCTGAGCCAACTGAAGGATCATCTCGAGATGATCCTTCAGTTGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-430s1c1
Sequence:CCGGGCTGTGAATCCTGAAGCAGATCTCGAGATCTGCTTCAGGATTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011266.2-2498s1c1
Sequence:CCGGCGTCTCTTCATCCTGGTCAAACTCGAGTTTGACCAGGATGAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-486s1c1
Sequence:CCGGGCACTCCACAACCCTCACAAACTCGAGTTTGTGAGGGTTGTGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011266.2-1502s21c1
Sequence:CCGGATACCCAGCAAGAAATCAATACTCGAGTATTGATTTCTTGCTGGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-703s21c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-460s21c1
Sequence:CCGGTCCTCACTGCAGGGAAGTTTCCTCGAGGAAACTTCCCTGCAGTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-790s21c1
Sequence:CCGGGCACTGTCACTTGCCAGTATGCTCGAGCATACTGGCAAGTGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-851s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011266
VALIDATED
RFXANK MISSION shRNA shRNA Plasmid DNA
regulatory factor X-associated ankyrin-containing protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-703s1c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011266.2-589s1c1
Sequence:CCGGCTGAGCCAACTGAAGGATCATCTCGAGATGATCCTTCAGTTGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-430s1c1
Sequence:CCGGGCTGTGAATCCTGAAGCAGATCTCGAGATCTGCTTCAGGATTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011266.2-2498s1c1
Sequence:CCGGCGTCTCTTCATCCTGGTCAAACTCGAGTTTGACCAGGATGAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-486s1c1
Sequence:CCGGGCACTCCACAACCCTCACAAACTCGAGTTTGTGAGGGTTGTGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011266.2-1502s21c1
Sequence:CCGGATACCCAGCAAGAAATCAATACTCGAGTATTGATTTCTTGCTGGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-703s21c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-460s21c1
Sequence:CCGGTCCTCACTGCAGGGAAGTTTCCTCGAGGAAACTTCCCTGCAGTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-790s21c1
Sequence:CCGGGCACTGTCACTTGCCAGTATGCTCGAGCATACTGGCAAGTGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-851s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011266
VALIDATED
RFXANK MISSION shRNA Lentiviral Transduction Particles
regulatory factor X-associated ankyrin-containing protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-703s1c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011266.2-589s1c1
Sequence:CCGGCTGAGCCAACTGAAGGATCATCTCGAGATGATCCTTCAGTTGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-430s1c1
Sequence:CCGGGCTGTGAATCCTGAAGCAGATCTCGAGATCTGCTTCAGGATTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011266.2-2498s1c1
Sequence:CCGGCGTCTCTTCATCCTGGTCAAACTCGAGTTTGACCAGGATGAAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011266.2-486s1c1
Sequence:CCGGGCACTCCACAACCCTCACAAACTCGAGTTTGTGAGGGTTGTGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011266.2-1502s21c1
Sequence:CCGGATACCCAGCAAGAAATCAATACTCGAGTATTGATTTCTTGCTGGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-703s21c1
Sequence:CCGGGCCTCAGCCTTTGGAGAAATTCTCGAGAATTTCTCCAAAGGCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-460s21c1
Sequence:CCGGTCCTCACTGCAGGGAAGTTTCCTCGAGGAAACTTCCCTGCAGTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-790s21c1
Sequence:CCGGGCACTGTCACTTGCCAGTATGCTCGAGCATACTGGCAAGTGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011266.2-851s21c1
Sequence:CCGGACGTGGACATCAACATCTATGCTCGAGCATAGATGTTGATGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)