EMAIL THIS PAGE TO A FRIEND

RGAG1

retrotransposon gag domain containing 1

108 Gene Product Result for
Synonyms: MAR9 MART9
UniProtKB ID: Q8NET4, Q9P2M8
Gene ID:
Mouse(209540) retrotransposon gag domain containing 1
domestic cat(101091429) retrotransposon gag domain containing 1
Horse(100059189) retrotransposon gag domain containing 1
dog(100685120) retrotransposon gag domain containing 1
naked mole-rat(101715166) retrotransposon gag domain containing 1
domestic guinea pig(100714937) retrotransposon gag domain containing 1
cow(101908132) retrotransposon gag domain containing 1
sheep(101113570) retrotransposon gag domain containing 1
cow(100141182) retrotransposon gag domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020769 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020769 Rosetta Predictions human pricing
XM_001472365 Rosetta Predictions mouse pricing
XM_001474906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170879 predicted 3509
2 SASI_Hs01_00170880 predicted 3900
3 SASI_Hs01_00170881 predicted 1997
4 SASI_Hs01_00170882 predicted 4126
5 SASI_Hs01_00170884 predicted 434
6 SASI_Hs01_00170885 predicted 3433
7 SASI_Hs01_00170886 predicted 4139
8 SASI_Hs01_00170887 predicted 470
9 SASI_Hs02_00353900 predicted 370
10 SASI_Hs02_00353901 predicted 3046
11 SASI_Hs01_00170883 predicted 2970
12 SASI_Hs01_00170888 predicted 3240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00361031 predicted 792
2 SASI_Mm02_00361032 predicted 1478
3 SASI_Mm02_00361033 predicted 1200
4 SASI_Mm02_00361034 predicted 561
5 SASI_Mm02_00361035 predicted 528
6 SASI_Mm02_00361036 predicted 578
7 SASI_Mm02_00361037 predicted 431
8 SASI_Mm02_00361038 predicted 769
9 SASI_Mm02_00361039 predicted 663
10 SASI_Mm02_00361040 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378711 predicted 3826
2 SASI_Mm02_00378712 predicted 1478
3 SASI_Mm02_00378713 predicted 3026
4 SASI_Mm02_00378714 predicted 1196
5 SASI_Mm02_00378715 predicted 563
6 SASI_Mm02_00378716 predicted 522
7 SASI_Mm02_00378717 predicted 573
8 SASI_Mm02_00378718 predicted 2380
9 SASI_Mm02_00378719 predicted 432
10 SASI_Mm02_00378720 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040434
RGAG1 MISSION shRNA Bacterial Glycerol Stock
retrotransposon gag domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-3589s21c1
Sequence:CCGGAGAAGATCACAGGGCTTATATCTCGAGATATAAGCCCTGTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-591s21c1
Sequence:CCGGATCCTCCGAGGCATCGTTAATCTCGAGATTAACGATGCCTCGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-462s21c1
Sequence:CCGGGATGATGTCAATACCTGATTTCTCGAGAAATCAGGTATTGACATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-432s21c1
Sequence:CCGGTACTTCAGACTATGGGTTAATCTCGAGATTAACCCATAGTCTGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-562s21c1
Sequence:CCGGGTGATATCTGCACCTATAATGCTCGAGCATTATAGGTGCAGATATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040434
RGAG1 MISSION shRNA shRNA Plasmid DNA
retrotransposon gag domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-3589s21c1
Sequence:CCGGAGAAGATCACAGGGCTTATATCTCGAGATATAAGCCCTGTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-591s21c1
Sequence:CCGGATCCTCCGAGGCATCGTTAATCTCGAGATTAACGATGCCTCGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-462s21c1
Sequence:CCGGGATGATGTCAATACCTGATTTCTCGAGAAATCAGGTATTGACATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-432s21c1
Sequence:CCGGTACTTCAGACTATGGGTTAATCTCGAGATTAACCCATAGTCTGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-562s21c1
Sequence:CCGGGTGATATCTGCACCTATAATGCTCGAGCATTATAGGTGCAGATATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040434
RGAG1 MISSION shRNA Lentiviral Transduction Particles
retrotransposon gag domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-3589s21c1
Sequence:CCGGAGAAGATCACAGGGCTTATATCTCGAGATATAAGCCCTGTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-591s21c1
Sequence:CCGGATCCTCCGAGGCATCGTTAATCTCGAGATTAACGATGCCTCGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-462s21c1
Sequence:CCGGGATGATGTCAATACCTGATTTCTCGAGAAATCAGGTATTGACATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-432s21c1
Sequence:CCGGTACTTCAGACTATGGGTTAATCTCGAGATTAACCCATAGTCTGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040434.1-562s21c1
Sequence:CCGGGTGATATCTGCACCTATAATGCTCGAGCATTATAGGTGCAGATATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020769
RGAG1 MISSION shRNA Bacterial Glycerol Stock
retrotransposon gag domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-4848s1c1
Sequence:CCGGCCCTTGTAACCCAGTAGACTTCTCGAGAAGTCTACTGGGTTACAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-355s1c1
Sequence:CCGGGCAGACGTACAGATTCTGCATCTCGAGATGCAGAATCTGTACGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1448s1c1
Sequence:CCGGCACCAGTAAGAGCTTTAGATTCTCGAGAATCTAAAGCTCTTACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-1473s21c1
Sequence:CCGGAGCAATGTCCACACCGCTAATCTCGAGATTAGCGGTGTGGACATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-2239s21c1
Sequence:CCGGGGGTTGTCTGCATCGCTAATGCTCGAGCATTAGCGATGCAGACAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1991s1c1
Sequence:CCGGCCCAAACCTCTGGATCAACATCTCGAGATGTTGATCCAGAGGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4223s1c1
Sequence:CCGGCAACAGCCTGTAAGCGGAATACTCGAGTATTCCGCTTACAGGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-3685s1c1
Sequence:CCGGGCACTCTGCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGCAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4392s1c1
Sequence:CCGGGAAGGCCCATACCAACAAGTACTCGAGTACTTGTTGGTATGGGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-5105s1c1
Sequence:CCGGGATCTGTTGTTTATGGCCTTTCTCGAGAAAGGCCATAAACAACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-694s21c1
Sequence:CCGGACGATGTCCGCAACGCTAATGCTCGAGCATTAGCGTTGCGGACATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020769
RGAG1 MISSION shRNA shRNA Plasmid DNA
retrotransposon gag domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-4848s1c1
Sequence:CCGGCCCTTGTAACCCAGTAGACTTCTCGAGAAGTCTACTGGGTTACAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-355s1c1
Sequence:CCGGGCAGACGTACAGATTCTGCATCTCGAGATGCAGAATCTGTACGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1448s1c1
Sequence:CCGGCACCAGTAAGAGCTTTAGATTCTCGAGAATCTAAAGCTCTTACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-1473s21c1
Sequence:CCGGAGCAATGTCCACACCGCTAATCTCGAGATTAGCGGTGTGGACATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-2239s21c1
Sequence:CCGGGGGTTGTCTGCATCGCTAATGCTCGAGCATTAGCGATGCAGACAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1991s1c1
Sequence:CCGGCCCAAACCTCTGGATCAACATCTCGAGATGTTGATCCAGAGGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4223s1c1
Sequence:CCGGCAACAGCCTGTAAGCGGAATACTCGAGTATTCCGCTTACAGGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-3685s1c1
Sequence:CCGGGCACTCTGCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGCAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4392s1c1
Sequence:CCGGGAAGGCCCATACCAACAAGTACTCGAGTACTTGTTGGTATGGGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-5105s1c1
Sequence:CCGGGATCTGTTGTTTATGGCCTTTCTCGAGAAAGGCCATAAACAACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-694s21c1
Sequence:CCGGACGATGTCCGCAACGCTAATGCTCGAGCATTAGCGTTGCGGACATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020769
RGAG1 MISSION shRNA Lentiviral Transduction Particles
retrotransposon gag domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-4848s1c1
Sequence:CCGGCCCTTGTAACCCAGTAGACTTCTCGAGAAGTCTACTGGGTTACAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-355s1c1
Sequence:CCGGGCAGACGTACAGATTCTGCATCTCGAGATGCAGAATCTGTACGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1448s1c1
Sequence:CCGGCACCAGTAAGAGCTTTAGATTCTCGAGAATCTAAAGCTCTTACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-1473s21c1
Sequence:CCGGAGCAATGTCCACACCGCTAATCTCGAGATTAGCGGTGTGGACATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-2239s21c1
Sequence:CCGGGGGTTGTCTGCATCGCTAATGCTCGAGCATTAGCGATGCAGACAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-1991s1c1
Sequence:CCGGCCCAAACCTCTGGATCAACATCTCGAGATGTTGATCCAGAGGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4223s1c1
Sequence:CCGGCAACAGCCTGTAAGCGGAATACTCGAGTATTCCGCTTACAGGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-3685s1c1
Sequence:CCGGGCACTCTGCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGCAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020769.1-4392s1c1
Sequence:CCGGGAAGGCCCATACCAACAAGTACTCGAGTACTTGTTGGTATGGGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020769.1-5105s1c1
Sequence:CCGGGATCTGTTGTTTATGGCCTTTCTCGAGAAAGGCCATAAACAACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020769.2-694s21c1
Sequence:CCGGACGATGTCCGCAACGCTAATGCTCGAGCATTAGCGTTGCGGACATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)