EMAIL THIS PAGE TO A FRIEND

RGAG4

retrotransposon gag domain containing 4

149 Gene Product Result for
Synonyms: 6430402L03Rik MAR5 MART5
UniProtKB ID: Q5HYW3, A7E2W7, Q8NCM4, Q9NPX1
Gene ID:
Mouse(331474) retrotransposon gag domain containing 4
cow(100851574) retrotransposon gag domain containing 4
sheep(101108455) retrotransposon gag domain containing 4
domestic guinea pig(101787211) retrotransposon gag domain containing 4
naked mole-rat(101723845) retrotransposon gag domain containing 4
dog(491953) retrotransposon gag domain containing 4
domestic cat(101095081) retrotransposon gag domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301331 ANTI-RGAG4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022141 MISSION® esiRNA esiRNA targeting mouse Rgag4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024455 Rosetta Predictions human pricing
NM_183318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307156 predicted 2334
2 SASI_Hs01_00114966 predicted 397
3 SASI_Hs01_00114967 predicted 1139
4 SASI_Hs01_00114968 predicted 1014
5 SASI_Hs01_00114970 predicted 2147
6 SASI_Hs01_00114971 predicted 400
7 SASI_Hs01_00114972 predicted 1194
8 SASI_Hs01_00114974 predicted 831
9 SASI_Hs01_00114975 predicted 648
10 SASI_Hs02_00307157 predicted 1017
11 SASI_Hs01_00114969 predicted 2337
12 SASI_Hs01_00114973 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035413 predicted 2680
2 SASI_Mm02_00350443 predicted 1288
3 SASI_Mm01_00035414 predicted 2681
4 SASI_Mm01_00035415 predicted 2670
5 SASI_Mm01_00035417 predicted 1063
6 SASI_Mm01_00035418 predicted 2669
7 SASI_Mm01_00035419 predicted 1119
8 SASI_Mm01_00035420 predicted 2671
9 SASI_Mm01_00035421 predicted 1021
10 SASI_Mm02_00350444 predicted 1124
11 SASI_Mm01_00035416 predicted 2578
12 SASI_Mm01_00035422 predicted 2520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024455
RGAG4 MISSION shRNA Bacterial Glycerol Stock
retrotransposon gag domain containing 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000117817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024455.1-3176s1c1
Sequence:CCGGGCTCCCTTCAATTTCAAGGAACTCGAGTTCCTTGAAATTGAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-577s1c1
Sequence:CCGGGCTCAGTGAGATCGAAGTCATCTCGAGATGACTTCGATCTCACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1222s1c1
Sequence:CCGGGCTCTTATGGTCAACAGAAATCTCGAGATTTCTGTTGACCATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1145s1c1
Sequence:CCGGGCCCAATTCTTGTCTTGGGATCTCGAGATCCCAAGACAAGAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024455
RGAG4 MISSION shRNA shRNA Plasmid DNA
retrotransposon gag domain containing 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000117817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024455.1-3176s1c1
Sequence:CCGGGCTCCCTTCAATTTCAAGGAACTCGAGTTCCTTGAAATTGAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-577s1c1
Sequence:CCGGGCTCAGTGAGATCGAAGTCATCTCGAGATGACTTCGATCTCACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1222s1c1
Sequence:CCGGGCTCTTATGGTCAACAGAAATCTCGAGATTTCTGTTGACCATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1145s1c1
Sequence:CCGGGCCCAATTCTTGTCTTGGGATCTCGAGATCCCAAGACAAGAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024455
RGAG4 MISSION shRNA Lentiviral Transduction Particles
retrotransposon gag domain containing 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000117817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024455.1-3176s1c1
Sequence:CCGGGCTCCCTTCAATTTCAAGGAACTCGAGTTCCTTGAAATTGAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-577s1c1
Sequence:CCGGGCTCAGTGAGATCGAAGTCATCTCGAGATGACTTCGATCTCACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1222s1c1
Sequence:CCGGGCTCTTATGGTCAACAGAAATCTCGAGATTTCTGTTGACCATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024455.1-1145s1c1
Sequence:CCGGGCCCAATTCTTGTCTTGGGATCTCGAGATCCCAAGACAAGAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183318
RGAG4 MISSION shRNA Bacterial Glycerol Stock
retrotransposon gag domain containing 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183318.1-1335s1c1
Sequence:CCGGCCCTTTGCACTAATTCCTAATCTCGAGATTAGGAATTAGTGCAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-642s1c1
Sequence:CCGGGAGTACGTCTCAGATGATCTTCTCGAGAAGATCATCTGAGACGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1650s1c1
Sequence:CCGGGATAGCGATGAGAATAAGTATCTCGAGATACTTATTCTCATCGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183318.1-3214s1c1
Sequence:CCGGCCTGTTGTTGAACTTCAGTTACTCGAGTAACTGAAGTTCAACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1206s1c1
Sequence:CCGGCGAAAGGAACTCTTATGGTCACTCGAGTGACCATAAGAGTTCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183318.3-3886s1c1
Sequence:CCGGGAAGTTAACGTATAGTCATTACTCGAGTAATGACTATACGTTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183318
RGAG4 MISSION shRNA shRNA Plasmid DNA
retrotransposon gag domain containing 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183318.1-1335s1c1
Sequence:CCGGCCCTTTGCACTAATTCCTAATCTCGAGATTAGGAATTAGTGCAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-642s1c1
Sequence:CCGGGAGTACGTCTCAGATGATCTTCTCGAGAAGATCATCTGAGACGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1650s1c1
Sequence:CCGGGATAGCGATGAGAATAAGTATCTCGAGATACTTATTCTCATCGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183318.1-3214s1c1
Sequence:CCGGCCTGTTGTTGAACTTCAGTTACTCGAGTAACTGAAGTTCAACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1206s1c1
Sequence:CCGGCGAAAGGAACTCTTATGGTCACTCGAGTGACCATAAGAGTTCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183318.3-3886s1c1
Sequence:CCGGGAAGTTAACGTATAGTCATTACTCGAGTAATGACTATACGTTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183318
RGAG4 MISSION shRNA Lentiviral Transduction Particles
retrotransposon gag domain containing 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183318.1-1335s1c1
Sequence:CCGGCCCTTTGCACTAATTCCTAATCTCGAGATTAGGAATTAGTGCAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-642s1c1
Sequence:CCGGGAGTACGTCTCAGATGATCTTCTCGAGAAGATCATCTGAGACGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1650s1c1
Sequence:CCGGGATAGCGATGAGAATAAGTATCTCGAGATACTTATTCTCATCGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183318.1-3214s1c1
Sequence:CCGGCCTGTTGTTGAACTTCAGTTACTCGAGTAACTGAAGTTCAACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183318.1-1206s1c1
Sequence:CCGGCGAAAGGAACTCTTATGGTCACTCGAGTGACCATAAGAGTTCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183318.3-3886s1c1
Sequence:CCGGGAAGTTAACGTATAGTCATTACTCGAGTAATGACTATACGTTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)