EMAIL THIS PAGE TO A FRIEND

RGL1

ral guanine nucleotide dissociation stimulator-like 1

47 Gene Product Result for
Synonyms: RGL
Gene ID:
Mouse(19731) ral guanine nucleotide dissociation stimulator,-like 1
Rat(289080) ral guanine nucleotide dissociation stimulator,-like 1
Thale Cress(842953) DELLA protein RGL1
dog(480038) ral guanine nucleotide dissociation stimulator-like 1
Horse(100051973) ral guanine nucleotide dissociation stimulator-like 1
domestic cat(101090074) ral guanine nucleotide dissociation stimulator-like 1
Zebrafish(402933) ral guanine nucleotide dissociation stimulator-like 1
chicken(424446) ral guanine nucleotide dissociation stimulator-like 1
domestic guinea pig(100714417) ral guanine nucleotide dissociation stimulator-like 1
naked mole-rat(101714703) ral guanine nucleotide dissociation stimulator-like 1
cow(522344) ral guanine nucleotide dissociation stimulator-like 1
sheep(101106955) ral guanine nucleotide dissociation stimulator-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015149 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015149 Rosetta Predictions human pricing
NM_001105957 Rosetta Predictions rat pricing
NM_016846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188031 predicted 1499
2 SASI_Hs01_00188032 predicted 819
3 SASI_Hs01_00188033 predicted 549
4 SASI_Hs01_00188034 predicted 845
5 SASI_Hs01_00188035 predicted 1049
6 SASI_Hs01_00188036 predicted 2721
7 SASI_Hs01_00188038 predicted 2725
8 SASI_Hs01_00188039 predicted 733
9 SASI_Hs01_00188040 predicted 1927
10 SASI_Hs02_00347101 predicted 2680
11 SASI_Hs01_00188037 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214212 predicted 2038
2 SASI_Rn02_00214213 predicted 2526
3 SASI_Rn02_00214214 predicted 1694
4 SASI_Rn02_00214215 predicted 2540
5 SASI_Rn02_00214216 predicted 1312
6 SASI_Rn02_00214217 predicted 1310
7 SASI_Rn02_00214218 predicted 766
8 SASI_Rn02_00214219 predicted 1439
9 SASI_Rn02_00214220 predicted 1386
10 SASI_Rn02_00214221 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160678 predicted 1169
2 SASI_Mm01_00160679 predicted 1414
3 SASI_Mm01_00160680 predicted 814
4 SASI_Mm01_00160681 predicted 2258
5 SASI_Mm01_00160682 predicted 1229
6 SASI_Mm01_00160683 predicted 209
7 SASI_Mm01_00160684 predicted 1026
8 SASI_Mm01_00160685 predicted 2219
9 SASI_Mm01_00160686 predicted 2374
10 SASI_Mm01_00160687 predicted 2089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015149
VALIDATED
RGL1 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1399s21c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-825s21c1
Sequence:CCGGGACAATGACTTTACCTATATCCTCGAGGATATAGGTAAAGTCATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1577s21c1
Sequence:CCGGTAATTCCATCTATCGGTTAAACTCGAGTTTAACCGATAGATGGAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2511s1c1
Sequence:CCGGCGCATCAGTGTGGAAGACAATCTCGAGATTGTCTTCCACACTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015149.3-3282s21c1
Sequence:CCGGGAGAACCTAGTCTCGTATATTCTCGAGAATATACGAGACTAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-742s1c1
Sequence:CCGGCCTGTAAGATCAGGACCATAACTCGAGTTATGGTCCTGATCTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-550s21c1
Sequence:CCGGTGGAAGATCATGTTCGAATATCTCGAGATATTCGAACATGATCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2472s1c1
Sequence:CCGGCCTGTTTACAACCAACAGAATCTCGAGATTCTGTTGGTTGTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1287s1c1
Sequence:CCGGGCACAACTCTTCAAGAAAGTACTCGAGTACTTTCTTGAAGAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1387s1c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015149
VALIDATED
RGL1 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1399s21c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-825s21c1
Sequence:CCGGGACAATGACTTTACCTATATCCTCGAGGATATAGGTAAAGTCATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1577s21c1
Sequence:CCGGTAATTCCATCTATCGGTTAAACTCGAGTTTAACCGATAGATGGAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2511s1c1
Sequence:CCGGCGCATCAGTGTGGAAGACAATCTCGAGATTGTCTTCCACACTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015149.3-3282s21c1
Sequence:CCGGGAGAACCTAGTCTCGTATATTCTCGAGAATATACGAGACTAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-742s1c1
Sequence:CCGGCCTGTAAGATCAGGACCATAACTCGAGTTATGGTCCTGATCTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-550s21c1
Sequence:CCGGTGGAAGATCATGTTCGAATATCTCGAGATATTCGAACATGATCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2472s1c1
Sequence:CCGGCCTGTTTACAACCAACAGAATCTCGAGATTCTGTTGGTTGTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1287s1c1
Sequence:CCGGGCACAACTCTTCAAGAAAGTACTCGAGTACTTTCTTGAAGAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1387s1c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015149
VALIDATED
RGL1 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1399s21c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-825s21c1
Sequence:CCGGGACAATGACTTTACCTATATCCTCGAGGATATAGGTAAAGTCATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-1577s21c1
Sequence:CCGGTAATTCCATCTATCGGTTAAACTCGAGTTTAACCGATAGATGGAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2511s1c1
Sequence:CCGGCGCATCAGTGTGGAAGACAATCTCGAGATTGTCTTCCACACTGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015149.3-3282s21c1
Sequence:CCGGGAGAACCTAGTCTCGTATATTCTCGAGAATATACGAGACTAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-742s1c1
Sequence:CCGGCCTGTAAGATCAGGACCATAACTCGAGTTATGGTCCTGATCTTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015149.3-550s21c1
Sequence:CCGGTGGAAGATCATGTTCGAATATCTCGAGATATTCGAACATGATCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015149.2-2472s1c1
Sequence:CCGGCCTGTTTACAACCAACAGAATCTCGAGATTCTGTTGGTTGTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1287s1c1
Sequence:CCGGGCACAACTCTTCAAGAAAGTACTCGAGTACTTTCTTGAAGAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015149.2-1387s1c1
Sequence:CCGGCCACCATCTCTCAGTTTAATACTCGAGTATTAAACTGAGAGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016846
VALIDATED
RGL1 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-879s21c1
Sequence:CCGGATTTGGTCTCAGCGGGATAAACTCGAGTTTATCCCGCTGAGACCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1027s21c1
Sequence:CCGGTCGAGAAGTGGATCAACATTGCTCGAGCAATGTTGATCCACTTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1947s21c1
Sequence:CCGGACGTGCAACAACAATCCTAAACTCGAGTTTAGGATTGTTGTTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-2496s21c1
Sequence:CCGGATTGGTGAAAGCGACAGATATCTCGAGATATCTGTCGCTTTCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016846.2-1052s1c1
Sequence:CCGGCGAATGTAGAATCCTGAAGAACTCGAGTTCTTCAGGATTCTACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1224s21c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1224s1c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016846.2-2665s1c1
Sequence:CCGGCGTGTGTGTATGCGTGTGTTTCTCGAGAAACACACGCATACACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-2255s1c1
Sequence:CCGGCGCCATGAATAGCCAAGTGAACTCGAGTTCACTTGGCTATTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1520s1c1
Sequence:CCGGCCAGAAGTTTATCCAGTGGTTCTCGAGAACCACTGGATAAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016846
VALIDATED
RGL1 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-879s21c1
Sequence:CCGGATTTGGTCTCAGCGGGATAAACTCGAGTTTATCCCGCTGAGACCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1027s21c1
Sequence:CCGGTCGAGAAGTGGATCAACATTGCTCGAGCAATGTTGATCCACTTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1947s21c1
Sequence:CCGGACGTGCAACAACAATCCTAAACTCGAGTTTAGGATTGTTGTTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-2496s21c1
Sequence:CCGGATTGGTGAAAGCGACAGATATCTCGAGATATCTGTCGCTTTCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016846.2-1052s1c1
Sequence:CCGGCGAATGTAGAATCCTGAAGAACTCGAGTTCTTCAGGATTCTACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1224s21c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1224s1c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016846.2-2665s1c1
Sequence:CCGGCGTGTGTGTATGCGTGTGTTTCTCGAGAAACACACGCATACACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-2255s1c1
Sequence:CCGGCGCCATGAATAGCCAAGTGAACTCGAGTTCACTTGGCTATTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1520s1c1
Sequence:CCGGCCAGAAGTTTATCCAGTGGTTCTCGAGAACCACTGGATAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016846
VALIDATED
RGL1 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-879s21c1
Sequence:CCGGATTTGGTCTCAGCGGGATAAACTCGAGTTTATCCCGCTGAGACCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1027s21c1
Sequence:CCGGTCGAGAAGTGGATCAACATTGCTCGAGCAATGTTGATCCACTTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1947s21c1
Sequence:CCGGACGTGCAACAACAATCCTAAACTCGAGTTTAGGATTGTTGTTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-2496s21c1
Sequence:CCGGATTGGTGAAAGCGACAGATATCTCGAGATATCTGTCGCTTTCACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016846.2-1052s1c1
Sequence:CCGGCGAATGTAGAATCCTGAAGAACTCGAGTTCTTCAGGATTCTACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016846.3-1224s21c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1224s1c1
Sequence:CCGGCGGGAGCTACTAATGAAGGAACTCGAGTTCCTTCATTAGTAGCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016846.2-2665s1c1
Sequence:CCGGCGTGTGTGTATGCGTGTGTTTCTCGAGAAACACACGCATACACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-2255s1c1
Sequence:CCGGCGCCATGAATAGCCAAGTGAACTCGAGTTCACTTGGCTATTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016846.2-1520s1c1
Sequence:CCGGCCAGAAGTTTATCCAGTGGTTCTCGAGAACCACTGGATAAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)