EMAIL THIS PAGE TO A FRIEND

RGL2

ral guanine nucleotide dissociation stimulator-like 2

85 Gene Product Result for
Synonyms: HKE1.5 KE1.5 RAB2L
UniProtKB ID: O15211, Q5STK0, Q9Y3F3
Gene ID:
Mouse(19732) ral guanine nucleotide dissociation stimulator-like 2
Rat(294283) ral guanine nucleotide dissociation stimulator-like 2
cow(504334) ral guanine nucleotide dissociation stimulator-like 2
sheep(101117118) ral guanine nucleotide dissociation stimulator-like 2
naked mole-rat(101717973) ral guanine nucleotide dissociation stimulator-like 2
Domestic Rabbit(100358432) ral guanine nucleotide dissociation stimulator-like 2
domestic guinea pig(100730560) ral guanine nucleotide dissociation stimulator-like 2
Thale Cress(821251) DELLA protein RGL2
Zebrafish(65227) ral guanine nucleotide dissociation stimulator-like 2
domestic cat(101088748) ral guanine nucleotide dissociation stimulator-like 2
dog(481739) ral guanine nucleotide dissociation stimulator-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040721 MISSION® esiRNA esiRNA targeting mouse Rgl2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004761 Rosetta Predictions human pricing
NM_212547 Rosetta Predictions rat pricing
NM_009059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091951 predicted 2269
2 SASI_Hs01_00091952 predicted 2589
3 SASI_Hs01_00091953 predicted 2076
4 SASI_Hs01_00091954 predicted 1563
5 SASI_Hs01_00091955 predicted 1303
6 SASI_Hs01_00091956 predicted 2615
7 SASI_Hs01_00091957 predicted 2655
8 SASI_Hs01_00091958 predicted 2268
9 SASI_Hs01_00091959 predicted 1706
10 SASI_Hs01_00091960 predicted 2584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083361 predicted 1516
2 SASI_Rn01_00083362 predicted 298
3 SASI_Rn01_00083363 predicted 1509
4 SASI_Rn01_00083364 predicted 2125
5 SASI_Rn01_00083365 predicted 288
6 SASI_Rn01_00083366 predicted 1470
7 SASI_Rn01_00083367 predicted 2227
8 SASI_Rn01_00083368 predicted 1573
9 SASI_Rn01_00083369 predicted 1534
10 SASI_Rn02_00270573 predicted 1539
11 SASI_Rn01_00083370 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117379 predicted 2141
2 SASI_Mm01_00117380 predicted 2207
3 SASI_Mm01_00117381 predicted 2535
4 SASI_Mm02_00315230 predicted 1241
5 SASI_Mm01_00117382 predicted 1640
6 SASI_Mm01_00117383 predicted 1777
7 SASI_Mm01_00117384 predicted 950
8 SASI_Mm01_00117385 predicted 2329
9 SASI_Mm02_00315231 predicted 1540
10 SASI_Mm01_00117386 predicted 1224
11 SASI_Mm01_00117377 predicted 1546
12 SASI_Mm01_00117378 predicted 2223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004761
VALIDATED
RGL2 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2142s21c1
Sequence:CCGGTTCGGCCAACATTGGTCATCTCTCGAGAGATGACCAATGTTGGCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2734s21c1
Sequence:CCGGGGATGGAGCTTCACACGATTTCTCGAGAAATCGTGTGAAGCTCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-1921s21c1
Sequence:CCGGGGAGAATGGATACATCAATTTCTCGAGAAATTGATGTATCCATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2523s1c1
Sequence:CCGGCCATCCTGAATGGTGGCAATTCTCGAGAATTGCCACCATTCAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2118s1c1
Sequence:CCGGGCAGTGTCTATAAGAGCATTTCTCGAGAAATGCTCTTATAGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-683s1c1
Sequence:CCGGCGGCTTGAGAGCTTCTTACTTCTCGAGAAGTAAGAAGCTCTCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-1552s1c1
Sequence:CCGGCCAGAATGAATGTCGTGGCTACTCGAGTAGCCACGACATTCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-1168s1c1
Sequence:CCGGCCGAAACTTCTCTTCAGTTTACTCGAGTAAACTGAAGAGAAGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004761
VALIDATED
RGL2 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2142s21c1
Sequence:CCGGTTCGGCCAACATTGGTCATCTCTCGAGAGATGACCAATGTTGGCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2734s21c1
Sequence:CCGGGGATGGAGCTTCACACGATTTCTCGAGAAATCGTGTGAAGCTCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-1921s21c1
Sequence:CCGGGGAGAATGGATACATCAATTTCTCGAGAAATTGATGTATCCATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2523s1c1
Sequence:CCGGCCATCCTGAATGGTGGCAATTCTCGAGAATTGCCACCATTCAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2118s1c1
Sequence:CCGGGCAGTGTCTATAAGAGCATTTCTCGAGAAATGCTCTTATAGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-683s1c1
Sequence:CCGGCGGCTTGAGAGCTTCTTACTTCTCGAGAAGTAAGAAGCTCTCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-1552s1c1
Sequence:CCGGCCAGAATGAATGTCGTGGCTACTCGAGTAGCCACGACATTCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-1168s1c1
Sequence:CCGGCCGAAACTTCTCTTCAGTTTACTCGAGTAAACTGAAGAGAAGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004761
VALIDATED
RGL2 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2142s21c1
Sequence:CCGGTTCGGCCAACATTGGTCATCTCTCGAGAGATGACCAATGTTGGCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-2734s21c1
Sequence:CCGGGGATGGAGCTTCACACGATTTCTCGAGAAATCGTGTGAAGCTCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004761.3-1921s21c1
Sequence:CCGGGGAGAATGGATACATCAATTTCTCGAGAAATTGATGTATCCATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2523s1c1
Sequence:CCGGCCATCCTGAATGGTGGCAATTCTCGAGAATTGCCACCATTCAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-2118s1c1
Sequence:CCGGGCAGTGTCTATAAGAGCATTTCTCGAGAAATGCTCTTATAGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-683s1c1
Sequence:CCGGCGGCTTGAGAGCTTCTTACTTCTCGAGAAGTAAGAAGCTCTCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004761.2-1552s1c1
Sequence:CCGGCCAGAATGAATGTCGTGGCTACTCGAGTAGCCACGACATTCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004761.2-1168s1c1
Sequence:CCGGCCGAAACTTCTCTTCAGTTTACTCGAGTAAACTGAAGAGAAGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009059
RGL2 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009059.2-2591s1c1
Sequence:CCGGGCCACAATATTAGAGCAGAAACTCGAGTTTCTGCTCTAATATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1635s1c1
Sequence:CCGGCCTCCGACCTAACTCTGATATCTCGAGATATCAGAGTTAGGTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-955s1c1
Sequence:CCGGGATGCGGAACTGTTTCTTAATCTCGAGATTAAGAAACAGTTCCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1642s1c1
Sequence:CCGGCCTAACTCTGATATCCAGCAACTCGAGTTGCTGGATATCAGAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-2228s1c1
Sequence:CCGGGTGTTATTAGTCGTGTCCTTACTCGAGTAAGGACACGACTAATAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009059.2-1542s21c1
Sequence:CCGGGGAGAATGGCTACATCAATTTCTCGAGAAATTGATGTAGCCATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009059
RGL2 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009059.2-2591s1c1
Sequence:CCGGGCCACAATATTAGAGCAGAAACTCGAGTTTCTGCTCTAATATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1635s1c1
Sequence:CCGGCCTCCGACCTAACTCTGATATCTCGAGATATCAGAGTTAGGTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-955s1c1
Sequence:CCGGGATGCGGAACTGTTTCTTAATCTCGAGATTAAGAAACAGTTCCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1642s1c1
Sequence:CCGGCCTAACTCTGATATCCAGCAACTCGAGTTGCTGGATATCAGAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-2228s1c1
Sequence:CCGGGTGTTATTAGTCGTGTCCTTACTCGAGTAAGGACACGACTAATAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009059.2-1542s21c1
Sequence:CCGGGGAGAATGGCTACATCAATTTCTCGAGAAATTGATGTAGCCATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009059
RGL2 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009059.2-2591s1c1
Sequence:CCGGGCCACAATATTAGAGCAGAAACTCGAGTTTCTGCTCTAATATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1635s1c1
Sequence:CCGGCCTCCGACCTAACTCTGATATCTCGAGATATCAGAGTTAGGTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-955s1c1
Sequence:CCGGGATGCGGAACTGTTTCTTAATCTCGAGATTAAGAAACAGTTCCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-1642s1c1
Sequence:CCGGCCTAACTCTGATATCCAGCAACTCGAGTTGCTGGATATCAGAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009059.2-2228s1c1
Sequence:CCGGGTGTTATTAGTCGTGTCCTTACTCGAGTAAGGACACGACTAATAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009059.2-1542s21c1
Sequence:CCGGGGAGAATGGCTACATCAATTTCTCGAGAAATTGATGTAGCCATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)