EMAIL THIS PAGE TO A FRIEND

RGL3

ral guanine nucleotide dissociation stimulator-like 3

171 Gene Product Result for
UniProtKB ID: Q3MIN7, B5ME84, B7ZL22, Q0P6G0
Gene ID:
Mouse(71746) ral guanine nucleotide dissociation stimulator-like 3
Rat(300444) ral guanine nucleotide dissociation stimulator-like 3
Thale Cress(831615) DELLA protein RGL3
domestic cat(101081610) ral guanine nucleotide dissociation stimulator-like 3
dog(484942) ral guanine nucleotide dissociation stimulator-like 3
domestic guinea pig(100725876) ral guanine nucleotide dissociation stimulator-like 3
naked mole-rat(101711763) ral guanine nucleotide dissociation stimulator-like 3
cow(785402) ral guanine nucleotide dissociation stimulator-like 3
sheep(101120830) ral guanine nucleotide dissociation stimulator-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290867 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035223 Rosetta Predictions human pricing
XM_930307 Rosetta Predictions human pricing
XM_934610 Rosetta Predictions human pricing
XM_934611 Rosetta Predictions human pricing
XM_934613 Rosetta Predictions human pricing
XM_934614 Rosetta Predictions human pricing
XM_934615 Rosetta Predictions human pricing
XM_934616 Rosetta Predictions human pricing
XM_934617 Rosetta Predictions human pricing
XM_934618 Rosetta Predictions human pricing
NM_001106805 Rosetta Predictions rat pricing
NM_023622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247016 predicted 690
2 SASI_Hs01_00247017 predicted 1152
3 SASI_Hs01_00247018 predicted 1932
4 SASI_Hs01_00247019 predicted 206
5 SASI_Hs01_00247020 predicted 1146
6 SASI_Hs01_00247021 predicted 676
7 SASI_Hs01_00247022 predicted 1890
8 SASI_Hs01_00247023 predicted 1628
9 SASI_Hs01_00247024 predicted 237
10 SASI_Hs01_00247025 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283419 predicted 2023
2 SASI_Hs01_00283420 predicted 1933
3 SASI_Hs01_00283421 predicted 213
4 SASI_Hs01_00283422 predicted 1929
5 SASI_Hs01_00283423 predicted 816
6 SASI_Hs01_00283424 predicted 229
7 SASI_Hs01_00283425 predicted 1350
8 SASI_Hs01_00283426 predicted 1937
9 SASI_Hs01_00283427 predicted 1437
10 SASI_Hs01_00283428 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300129 predicted 711
2 SASI_Hs01_00300130 predicted 770
3 SASI_Hs01_00300131 predicted 738
4 SASI_Hs01_00300132 predicted 225
5 SASI_Hs01_00300133 predicted 242
6 SASI_Hs01_00300134 predicted 807
7 SASI_Hs01_00300135 predicted 226
8 SASI_Hs01_00300136 predicted 250
9 SASI_Hs01_00300137 predicted 700
10 SASI_Hs01_00300138 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275481 predicted 405
2 SASI_Hs01_00275482 predicted 392
3 SASI_Hs01_00275483 predicted 205
4 SASI_Hs01_00275484 predicted 417
5 SASI_Hs01_00275485 predicted 261
6 SASI_Hs01_00275486 predicted 890
7 SASI_Hs01_00275487 predicted 191
8 SASI_Hs01_00275488 predicted 867
9 SASI_Hs01_00275489 predicted 926
10 SASI_Hs01_00275490 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286193 predicted 1400
2 SASI_Hs01_00286194 predicted 775
3 SASI_Hs01_00286195 predicted 1303
4 SASI_Hs01_00286196 predicted 1404
5 SASI_Hs01_00286197 predicted 741
6 SASI_Hs01_00286198 predicted 1303
7 SASI_Hs01_00286199 predicted 226
8 SASI_Hs01_00286200 predicted 1393
9 SASI_Hs01_00286201 predicted 1308
10 SASI_Hs01_00286202 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281839 predicted 1612
2 SASI_Hs01_00281840 predicted 1513
3 SASI_Hs01_00281841 predicted 1605
4 SASI_Hs01_00281842 predicted 1519
5 SASI_Hs01_00281843 predicted 1602
6 SASI_Hs01_00281844 predicted 1524
7 SASI_Hs01_00281845 predicted 1581
8 SASI_Hs01_00281846 predicted 1526
9 SASI_Hs01_00281847 predicted 1599
10 SASI_Hs01_00281848 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275950 predicted 1402
2 SASI_Hs01_00275951 predicted 767
3 SASI_Hs01_00275952 predicted 1312
4 SASI_Hs01_00275953 predicted 1395
5 SASI_Hs01_00275954 predicted 739
6 SASI_Hs01_00275955 predicted 1305
7 SASI_Hs01_00275956 predicted 232
8 SASI_Hs01_00275957 predicted 1401
9 SASI_Hs01_00275958 predicted 1315
10 SASI_Hs01_00275959 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290276 predicted 1397
2 SASI_Hs01_00290277 predicted 768
3 SASI_Hs01_00290278 predicted 1311
4 SASI_Hs01_00290279 predicted 1398
5 SASI_Hs01_00290280 predicted 745
6 SASI_Hs01_00290281 predicted 1309
7 SASI_Hs01_00290282 predicted 229
8 SASI_Hs01_00290283 predicted 1391
9 SASI_Hs01_00290284 predicted 1311
10 SASI_Hs01_00290285 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286047 predicted 393
2 SASI_Hs01_00286048 predicted 397
3 SASI_Hs01_00286049 predicted 310
4 SASI_Hs01_00286050 predicted 296
5 SASI_Hs01_00286051 predicted 597
6 SASI_Hs01_00286052 predicted 666
7 SASI_Hs01_00286053 predicted 498
8 SASI_Hs01_00286054 predicted 309
9 SASI_Hs01_00286055 predicted 456
10 SASI_Hs01_00286056 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283360 predicted 1719
2 SASI_Hs01_00283361 predicted 1720
3 SASI_Hs01_00283362 predicted 1632
4 SASI_Hs01_00283363 predicted 1620
5 SASI_Hs01_00283364 predicted 513
6 SASI_Hs01_00283365 predicted 1053
7 SASI_Hs01_00283366 predicted 1632
8 SASI_Hs01_00283367 predicted 1142
9 SASI_Hs01_00283368 predicted 1677
10 SASI_Hs01_00283369 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222578 predicted 1209
2 SASI_Rn02_00222579 predicted 875
3 SASI_Rn02_00222580 predicted 1369
4 SASI_Rn02_00222581 predicted 1235
5 SASI_Rn02_00222582 predicted 1227
6 SASI_Rn02_00222583 predicted 1143
7 SASI_Rn02_00222584 predicted 496
8 SASI_Rn02_00222585 predicted 1128
9 SASI_Rn02_00222586 predicted 978
10 SASI_Rn02_00222587 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133601 predicted 2233
2 SASI_Mm01_00133602 predicted 1946
3 SASI_Mm01_00133603 predicted 2225
4 SASI_Mm01_00133604 predicted 463
5 SASI_Mm01_00133605 predicted 1352
6 SASI_Mm01_00133606 predicted 818
7 SASI_Mm01_00133607 predicted 2028
8 SASI_Mm01_00133608 predicted 1208
9 SASI_Mm01_00133609 predicted 1586
10 SASI_Mm01_00133610 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023622
RGL3 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000110085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023622.2-2237s1c1
Sequence:CCGGCTTGGATTCTACTACTATCAACTCGAGTTGATAGTAGTAGAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-516s1c1
Sequence:CCGGGCGAAATCATCCTCAGGACTTCTCGAGAAGTCCTGAGGATGATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1914s1c1
Sequence:CCGGCATCAACAATAACCACGGGAACTCGAGTTCCCGTGGTTATTGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1599s1c1
Sequence:CCGGGCGACGCATCAGCCTCACAAACTCGAGTTTGTGAGGCTGATGCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023622
RGL3 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000110085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023622.2-2237s1c1
Sequence:CCGGCTTGGATTCTACTACTATCAACTCGAGTTGATAGTAGTAGAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-516s1c1
Sequence:CCGGGCGAAATCATCCTCAGGACTTCTCGAGAAGTCCTGAGGATGATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1914s1c1
Sequence:CCGGCATCAACAATAACCACGGGAACTCGAGTTCCCGTGGTTATTGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1599s1c1
Sequence:CCGGGCGACGCATCAGCCTCACAAACTCGAGTTTGTGAGGCTGATGCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023622
RGL3 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000110085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023622.2-2237s1c1
Sequence:CCGGCTTGGATTCTACTACTATCAACTCGAGTTGATAGTAGTAGAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-516s1c1
Sequence:CCGGGCGAAATCATCCTCAGGACTTCTCGAGAAGTCCTGAGGATGATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1914s1c1
Sequence:CCGGCATCAACAATAACCACGGGAACTCGAGTTCCCGTGGTTATTGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023622.2-1599s1c1
Sequence:CCGGGCGACGCATCAGCCTCACAAACTCGAGTTTGTGAGGCTGATGCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290867
RGL3 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2097s1c1
Sequence:CCGGGAACCTGTATCGAAGCATCTTCTCGAGAAGATGCTTCGATACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-1324s1c1
Sequence:CCGGCCGCTATCTACTTTCAGGAAACTCGAGTTTCCTGAAAGTAGATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2155s1c1
Sequence:CCGGCGAGCCTTGCAGAAGCACAATCTCGAGATTGTGCTTCTGCAAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-987s1c1
Sequence:CCGGCCTCATAGACTTGGAGCTCTTCTCGAGAAGAGCTCCAAGTCTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2233s1c1
Sequence:CCGGGTGCTCCTGATTCCTGACAATCTCGAGATTGTCAGGAATCAGGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290867
RGL3 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2097s1c1
Sequence:CCGGGAACCTGTATCGAAGCATCTTCTCGAGAAGATGCTTCGATACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-1324s1c1
Sequence:CCGGCCGCTATCTACTTTCAGGAAACTCGAGTTTCCTGAAAGTAGATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2155s1c1
Sequence:CCGGCGAGCCTTGCAGAAGCACAATCTCGAGATTGTGCTTCTGCAAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-987s1c1
Sequence:CCGGCCTCATAGACTTGGAGCTCTTCTCGAGAAGAGCTCCAAGTCTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2233s1c1
Sequence:CCGGGTGCTCCTGATTCCTGACAATCTCGAGATTGTCAGGAATCAGGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290867
RGL3 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2097s1c1
Sequence:CCGGGAACCTGTATCGAAGCATCTTCTCGAGAAGATGCTTCGATACAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-1324s1c1
Sequence:CCGGCCGCTATCTACTTTCAGGAAACTCGAGTTTCCTGAAAGTAGATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2155s1c1
Sequence:CCGGCGAGCCTTGCAGAAGCACAATCTCGAGATTGTGCTTCTGCAAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-987s1c1
Sequence:CCGGCCTCATAGACTTGGAGCTCTTCTCGAGAAGAGCTCCAAGTCTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290867.2-2233s1c1
Sequence:CCGGGTGCTCCTGATTCCTGACAATCTCGAGATTGTCAGGAATCAGGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)