EMAIL THIS PAGE TO A FRIEND

RGL4

ral guanine nucleotide dissociation stimulator-like 4

21 Gene Product Result for
Synonyms: Rgr
Species: Human RGL4(266747)
UniProtKB ID: Q8IZJ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054861 MISSION® esiRNA esiRNA human RGL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167747 predicted 1845
2 SASI_Hs01_00167748 predicted 2459
3 SASI_Hs01_00167749 predicted 2225
4 SASI_Hs01_00167751 predicted 2548
5 SASI_Hs01_00167753 predicted 2261
6 SASI_Hs01_00167754 predicted 2454
7 SASI_Hs01_00167755 predicted 1498
8 SASI_Hs02_00367357 predicted 1487
9 SASI_Hs02_00367358 predicted 2137
10 SASI_Hs02_00367359 predicted 2421
11 SASI_Hs01_00167746 predicted 2082
12 SASI_Hs01_00167750 predicted 2137
13 SASI_Hs01_00167752 predicted 2127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153615
RGL4 MISSION shRNA Bacterial Glycerol Stock
ral guanine nucleotide dissociation stimulator-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1771s1c1
Sequence:CCGGCGTGGGTCTGTAAAGAACCAACTCGAGTTGGTTCTTTACAGACCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2538s1c1
Sequence:CCGGCAGTGACAAAGAGAGCTACAACTCGAGTTGTAGCTCTCTTTGTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1890s1c1
Sequence:CCGGCCACGAATGCTTGGGCTGCATCTCGAGATGCAGCCCAAGCATTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2409s1c1
Sequence:CCGGCAACACCAACAAGAGGAGCAACTCGAGTTGCTCCTCTTGTTGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1559s1c1
Sequence:CCGGCTGGGCAACACGCATTAACAACTCGAGTTGTTAATGCGTGTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2433s21c1
Sequence:CCGGGGTCCGAGTTCTGCAGGAAATCTCGAGATTTCCTGCAGAACTCGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2509s21c1
Sequence:CCGGGTCACCTATTTCACAAGAATGCTCGAGCATTCTTGTGAAATAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2131s21c1
Sequence:CCGGGCTCTGTGCAGCAACCCAATACTCGAGTATTGGGTTGCTGCACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2486s21c1
Sequence:CCGGGGCTTCGGCCTCTTGAGAAATCTCGAGATTTCTCAAGAGGCCGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153615
RGL4 MISSION shRNA shRNA Plasmid DNA
ral guanine nucleotide dissociation stimulator-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1771s1c1
Sequence:CCGGCGTGGGTCTGTAAAGAACCAACTCGAGTTGGTTCTTTACAGACCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2538s1c1
Sequence:CCGGCAGTGACAAAGAGAGCTACAACTCGAGTTGTAGCTCTCTTTGTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1890s1c1
Sequence:CCGGCCACGAATGCTTGGGCTGCATCTCGAGATGCAGCCCAAGCATTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2409s1c1
Sequence:CCGGCAACACCAACAAGAGGAGCAACTCGAGTTGCTCCTCTTGTTGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1559s1c1
Sequence:CCGGCTGGGCAACACGCATTAACAACTCGAGTTGTTAATGCGTGTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2433s21c1
Sequence:CCGGGGTCCGAGTTCTGCAGGAAATCTCGAGATTTCCTGCAGAACTCGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2509s21c1
Sequence:CCGGGTCACCTATTTCACAAGAATGCTCGAGCATTCTTGTGAAATAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2131s21c1
Sequence:CCGGGCTCTGTGCAGCAACCCAATACTCGAGTATTGGGTTGCTGCACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2486s21c1
Sequence:CCGGGGCTTCGGCCTCTTGAGAAATCTCGAGATTTCTCAAGAGGCCGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153615
RGL4 MISSION shRNA Lentiviral Transduction Particles
ral guanine nucleotide dissociation stimulator-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1771s1c1
Sequence:CCGGCGTGGGTCTGTAAAGAACCAACTCGAGTTGGTTCTTTACAGACCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2538s1c1
Sequence:CCGGCAGTGACAAAGAGAGCTACAACTCGAGTTGTAGCTCTCTTTGTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1890s1c1
Sequence:CCGGCCACGAATGCTTGGGCTGCATCTCGAGATGCAGCCCAAGCATTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-2409s1c1
Sequence:CCGGCAACACCAACAAGAGGAGCAACTCGAGTTGCTCCTCTTGTTGGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153615.1-1559s1c1
Sequence:CCGGCTGGGCAACACGCATTAACAACTCGAGTTGTTAATGCGTGTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2433s21c1
Sequence:CCGGGGTCCGAGTTCTGCAGGAAATCTCGAGATTTCCTGCAGAACTCGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2509s21c1
Sequence:CCGGGTCACCTATTTCACAAGAATGCTCGAGCATTCTTGTGAAATAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2131s21c1
Sequence:CCGGGCTCTGTGCAGCAACCCAATACTCGAGTATTGGGTTGCTGCACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153615.1-2486s21c1
Sequence:CCGGGGCTTCGGCCTCTTGAGAAATCTCGAGATTTCTCAAGAGGCCGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)