EMAIL THIS PAGE TO A FRIEND

RGMA

RGM domain family, member A

78 Gene Product Result for
Synonyms: RGM
UniProtKB ID: Q96B86, B2RTW1, Q0JV97, Q8NC80, Q9H0E6, Q9NPM3
Gene ID:
Human(56963) Summary: This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(244058) RGM domain family, member A
Rat(308739) RGM domain family, member A
Zebrafish(414272) RGM domain family, member A
domestic cat(101096571) RGM domain family, member A
dog(488719) RGM domain family, member A
chicken(395214) RGM domain family, member A
cow(518756) RGM domain family, member A
sheep(101113702) RGM domain family, member A
naked mole-rat(101715597) RGM domain family, member A
domestic guinea pig(100735575) RGM domain family, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1666 Human RGM-A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020211 Rosetta Predictions human pricing
NM_001107524 Rosetta Predictions rat pricing
NM_177740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189408 predicted 1927
2 SASI_Hs01_00189409 predicted 2045
3 SASI_Hs01_00189410 predicted 1818
4 SASI_Hs01_00189411 predicted 1417
5 SASI_Hs01_00189412 predicted 691
6 SASI_Hs01_00189413 predicted 701
7 SASI_Hs01_00189414 predicted 698
8 SASI_Hs01_00189415 predicted 408
9 SASI_Hs01_00189416 predicted 992
10 SASI_Hs01_00189417 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229675 predicted 1679
2 SASI_Rn02_00229676 predicted 1181
3 SASI_Rn02_00229677 predicted 779
4 SASI_Rn02_00229678 predicted 1567
5 SASI_Rn02_00229679 predicted 553
6 SASI_Rn02_00229680 predicted 1160
7 SASI_Rn02_00229681 predicted 928
8 SASI_Rn02_00229682 predicted 485
9 SASI_Rn02_00229683 predicted 1916
10 SASI_Rn02_00229684 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029280 predicted 915
2 SASI_Mm01_00029281 predicted 1003
3 SASI_Mm01_00029282 predicted 1574
4 SASI_Mm01_00029283 predicted 1334
5 SASI_Mm01_00029284 predicted 784
6 SASI_Mm01_00029285 predicted 779
7 SASI_Mm01_00029286 predicted 935
8 SASI_Mm01_00029287 predicted 1075
9 SASI_Mm01_00029288 predicted 1451
10 SASI_Mm01_00029289 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020211
RGMA MISSION shRNA Bacterial Glycerol Stock
RGM domain family, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1169s21c1
Sequence:CCGGTGCCAGAGGAAGTGGTCAATGCTCGAGCATTGACCACTTCCTCTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1800s21c1
Sequence:CCGGAGTGCACGTGACAAGGTTGTGCTCGAGCACAACCTTGTCACGTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-704s1c1
Sequence:CCGGCTGCCATTACGAGAAGAGCTTCTCGAGAAGCTCTTCTCGTAATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1043s1c1
Sequence:CCGGCAGCCTGAAGATCACTGAGAACTCGAGTTCTCAGTGATCTTCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1822s21c1
Sequence:CCGGTGACTGGTGCCATGATGTTTGCTCGAGCAAACATCATGGCACCAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1475s1c1
Sequence:CCGGCAAGATGCTCCACTCCAACAACTCGAGTTGTTGGAGTGGAGCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020211.1-2345s1c1
Sequence:CCGGGCTTAGAAAGTCGAAGTGCTTCTCGAGAAGCACTTCGACTTTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1625s21c1
Sequence:CCGGTGTTCTGCTAGACGCGTAGATCTCGAGATCTACGCGTCTAGCAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-842s1c1
Sequence:CCGGCGACAATAATTACCTGAACGTCTCGAGACGTTCAGGTAATTATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020211
RGMA MISSION shRNA shRNA Plasmid DNA
RGM domain family, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1169s21c1
Sequence:CCGGTGCCAGAGGAAGTGGTCAATGCTCGAGCATTGACCACTTCCTCTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1800s21c1
Sequence:CCGGAGTGCACGTGACAAGGTTGTGCTCGAGCACAACCTTGTCACGTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-704s1c1
Sequence:CCGGCTGCCATTACGAGAAGAGCTTCTCGAGAAGCTCTTCTCGTAATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1043s1c1
Sequence:CCGGCAGCCTGAAGATCACTGAGAACTCGAGTTCTCAGTGATCTTCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1822s21c1
Sequence:CCGGTGACTGGTGCCATGATGTTTGCTCGAGCAAACATCATGGCACCAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1475s1c1
Sequence:CCGGCAAGATGCTCCACTCCAACAACTCGAGTTGTTGGAGTGGAGCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020211.1-2345s1c1
Sequence:CCGGGCTTAGAAAGTCGAAGTGCTTCTCGAGAAGCACTTCGACTTTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1625s21c1
Sequence:CCGGTGTTCTGCTAGACGCGTAGATCTCGAGATCTACGCGTCTAGCAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-842s1c1
Sequence:CCGGCGACAATAATTACCTGAACGTCTCGAGACGTTCAGGTAATTATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020211
RGMA MISSION shRNA Lentiviral Transduction Particles
RGM domain family, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1169s21c1
Sequence:CCGGTGCCAGAGGAAGTGGTCAATGCTCGAGCATTGACCACTTCCTCTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1800s21c1
Sequence:CCGGAGTGCACGTGACAAGGTTGTGCTCGAGCACAACCTTGTCACGTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-704s1c1
Sequence:CCGGCTGCCATTACGAGAAGAGCTTCTCGAGAAGCTCTTCTCGTAATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1043s1c1
Sequence:CCGGCAGCCTGAAGATCACTGAGAACTCGAGTTCTCAGTGATCTTCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020211.2-1822s21c1
Sequence:CCGGTGACTGGTGCCATGATGTTTGCTCGAGCAAACATCATGGCACCAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-1475s1c1
Sequence:CCGGCAAGATGCTCCACTCCAACAACTCGAGTTGTTGGAGTGGAGCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020211.1-2345s1c1
Sequence:CCGGGCTTAGAAAGTCGAAGTGCTTCTCGAGAAGCACTTCGACTTTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020211.2-1625s21c1
Sequence:CCGGTGTTCTGCTAGACGCGTAGATCTCGAGATCTACGCGTCTAGCAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020211.1-842s1c1
Sequence:CCGGCGACAATAATTACCTGAACGTCTCGAGACGTTCAGGTAATTATTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177740
RGMA MISSION shRNA Bacterial Glycerol Stock
RGM domain family, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-814s1c1
Sequence:CCGGTGGCCTCTCATCGACAATAATCTCGAGATTATTGTCGATGAGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-686s1c1
Sequence:CCGGTCTGCCACTATGAGAAGAGTTCTCGAGAACTCTTCTCATAGTGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-768s1c1
Sequence:CCGGCAGGACTTTCACAGACCACTTCTCGAGAAGTGGTCTGTGAAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177740.2-1905s1c1
Sequence:CCGGCGCAACAAGGTTGTGGTGATTCTCGAGAATCACCACAACCTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-1429s1c1
Sequence:CCGGGCCTACTATGCTTTGGAGGATCTCGAGATCCTCCAAAGCATAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177740
RGMA MISSION shRNA shRNA Plasmid DNA
RGM domain family, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-814s1c1
Sequence:CCGGTGGCCTCTCATCGACAATAATCTCGAGATTATTGTCGATGAGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-686s1c1
Sequence:CCGGTCTGCCACTATGAGAAGAGTTCTCGAGAACTCTTCTCATAGTGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-768s1c1
Sequence:CCGGCAGGACTTTCACAGACCACTTCTCGAGAAGTGGTCTGTGAAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177740.2-1905s1c1
Sequence:CCGGCGCAACAAGGTTGTGGTGATTCTCGAGAATCACCACAACCTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-1429s1c1
Sequence:CCGGGCCTACTATGCTTTGGAGGATCTCGAGATCCTCCAAAGCATAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177740
RGMA MISSION shRNA Lentiviral Transduction Particles
RGM domain family, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-814s1c1
Sequence:CCGGTGGCCTCTCATCGACAATAATCTCGAGATTATTGTCGATGAGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-686s1c1
Sequence:CCGGTCTGCCACTATGAGAAGAGTTCTCGAGAACTCTTCTCATAGTGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-768s1c1
Sequence:CCGGCAGGACTTTCACAGACCACTTCTCGAGAAGTGGTCTGTGAAAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177740.2-1905s1c1
Sequence:CCGGCGCAACAAGGTTGTGGTGATTCTCGAGAATCACCACAACCTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177740.2-1429s1c1
Sequence:CCGGGCCTACTATGCTTTGGAGGATCTCGAGATCCTCCAAAGCATAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)