EMAIL THIS PAGE TO A FRIEND

RGN

regucalcin

69 Gene Product Result for
Synonyms: GNL RC SMP30
UniProtKB ID: Q15493, A4FTW1, A8K271, Q53FC9, Q5JRR5
Gene ID:
Human(9104) Summary: The protein encoded by this gene is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11.3-Xp11.23. Alternative splicing results in two transcript variants having different 5' UTRs, but encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(19733) regucalcin
Rat(25106) regucalcin (senescence marker protein-30)
fruit fly(40368) regeneration
Horse(100060684) regucalcin (senescence marker protein-30)
domestic cat(101096640) regucalcin (senescence marker protein-30)
dog(480893) regucalcin (senescence marker protein-30)
chicken(395480) regucalcin
Zebrafish(403070) regucalcin
cow(280910) regucalcin (senescence marker protein-30)
sheep(100171395) regucalcin (senescence marker protein-30)
naked mole-rat(101714522) regucalcin (senescence marker protein-30)
Domestic Rabbit(100008619) regucalcin (senescence marker protein-30)
domestic guinea pig(100725528) regucalcin (senescence marker protein-30)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004683 Rosetta Predictions human pricing
NM_152869 Rosetta Predictions human pricing
NM_031546 Rosetta Predictions rat pricing
NM_009060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338115 predicted 1099
2 SASI_Hs01_00243719 predicted 707
3 SASI_Hs01_00243720 predicted 1304
4 SASI_Hs01_00243721 predicted 1215
5 SASI_Hs01_00243722 predicted 1274
6 SASI_Hs01_00243724 predicted 1054
7 SASI_Hs01_00243725 predicted 1057
8 SASI_Hs01_00243726 predicted 608
9 SASI_Hs01_00243727 predicted 1225
10 SASI_Hs02_00338116 predicted 794
11 SASI_Hs01_00243723 predicted 1049
12 SASI_Hs01_00243728 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366812 predicted 1723
2 SASI_Hs01_00234598 predicted 1322
3 SASI_Hs01_00234599 predicted 1924
4 SASI_Hs01_00234600 predicted 1838
5 SASI_Hs01_00234601 predicted 1895
6 SASI_Hs01_00234603 predicted 1679
7 SASI_Hs01_00234604 predicted 1677
8 SASI_Hs01_00234605 predicted 1227
9 SASI_Hs01_00234606 predicted 1853
10 SASI_Hs02_00366813 predicted 1414
11 SASI_Hs01_00234602 predicted 1666
12 SASI_Hs01_00234607 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069623 predicted 977
2 SASI_Rn01_00069624 predicted 1056
3 SASI_Rn01_00069625 predicted 1030
4 SASI_Rn01_00069626 predicted 337
5 SASI_Rn02_00264720 predicted 1039
6 SASI_Rn01_00069627 predicted 538
7 SASI_Rn01_00069628 predicted 801
8 SASI_Rn01_00069629 predicted 329
9 SASI_Rn01_00069631 predicted 561
10 SASI_Rn01_00069632 predicted 647
11 SASI_Rn01_00069630 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189444 predicted 327
2 SASI_Mm01_00189445 predicted 599
3 SASI_Mm01_00189446 predicted 515
4 SASI_Mm01_00189447 predicted 778
5 SASI_Mm01_00189448 predicted 685
6 SASI_Mm01_00189449 predicted 536
7 SASI_Mm01_00189450 predicted 286
8 SASI_Mm01_00189451 predicted 784
9 SASI_Mm02_00315232 predicted 610
10 SASI_Mm01_00189453 predicted 631
11 SASI_Mm01_00189452 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004683
RGN MISSION shRNA Bacterial Glycerol Stock
regucalcin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-464s21c1
Sequence:CCGGGTTTGCCGGTGGGATTCATTCCTCGAGGAATGAATCCCACCGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1307s21c1
Sequence:CCGGCTGAAATTTCAATCTAGTTAGCTCGAGCTAACTAGATTGAAATTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1245s21c1
Sequence:CCGGGATGAGGACAGGTCTTCTTTCCTCGAGGAAAGAAGACCTGTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1011s21c1
Sequence:CCGGGAGGAAGAGTGATTCGTTTAGCTCGAGCTAAACGAATCACTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-861s1c1
Sequence:CCGGACTGTGAAGTTGCCTGTTGATCTCGAGATCAACAGGCAACTTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-716s1c1
Sequence:CCGGCAACCGCAGAAGTGTTTACAACTCGAGTTGTAAACACTTCTGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-975s1c1
Sequence:CCGGCAACCTGAAGCTGGTGGAATTCTCGAGAATTCCACCAGCTTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-224s1c1
Sequence:CCGGAGTGTCCAACTCTCTGCTCTTCTCGAGAAGAGCAGAGAGTTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1459s21c1
Sequence:CCGGACTATAGAAGGGCGAAGAATCCTCGAGGATTCTTCGCCCTTCTATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004683
RGN MISSION shRNA shRNA Plasmid DNA
regucalcin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-464s21c1
Sequence:CCGGGTTTGCCGGTGGGATTCATTCCTCGAGGAATGAATCCCACCGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1307s21c1
Sequence:CCGGCTGAAATTTCAATCTAGTTAGCTCGAGCTAACTAGATTGAAATTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1245s21c1
Sequence:CCGGGATGAGGACAGGTCTTCTTTCCTCGAGGAAAGAAGACCTGTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1011s21c1
Sequence:CCGGGAGGAAGAGTGATTCGTTTAGCTCGAGCTAAACGAATCACTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-861s1c1
Sequence:CCGGACTGTGAAGTTGCCTGTTGATCTCGAGATCAACAGGCAACTTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-716s1c1
Sequence:CCGGCAACCGCAGAAGTGTTTACAACTCGAGTTGTAAACACTTCTGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-975s1c1
Sequence:CCGGCAACCTGAAGCTGGTGGAATTCTCGAGAATTCCACCAGCTTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-224s1c1
Sequence:CCGGAGTGTCCAACTCTCTGCTCTTCTCGAGAAGAGCAGAGAGTTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1459s21c1
Sequence:CCGGACTATAGAAGGGCGAAGAATCCTCGAGGATTCTTCGCCCTTCTATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004683
RGN MISSION shRNA Lentiviral Transduction Particles
regucalcin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-464s21c1
Sequence:CCGGGTTTGCCGGTGGGATTCATTCCTCGAGGAATGAATCCCACCGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1307s21c1
Sequence:CCGGCTGAAATTTCAATCTAGTTAGCTCGAGCTAACTAGATTGAAATTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1245s21c1
Sequence:CCGGGATGAGGACAGGTCTTCTTTCCTCGAGGAAAGAAGACCTGTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004683.4-1011s21c1
Sequence:CCGGGAGGAAGAGTGATTCGTTTAGCTCGAGCTAAACGAATCACTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-861s1c1
Sequence:CCGGACTGTGAAGTTGCCTGTTGATCTCGAGATCAACAGGCAACTTCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-716s1c1
Sequence:CCGGCAACCGCAGAAGTGTTTACAACTCGAGTTGTAAACACTTCTGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-975s1c1
Sequence:CCGGCAACCTGAAGCTGGTGGAATTCTCGAGAATTCCACCAGCTTCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004683.3-224s1c1
Sequence:CCGGAGTGTCCAACTCTCTGCTCTTCTCGAGAAGAGCAGAGAGTTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004683.4-1459s21c1
Sequence:CCGGACTATAGAAGGGCGAAGAATCCTCGAGGATTCTTCGCCCTTCTATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009060
RGN MISSION shRNA Bacterial Glycerol Stock
regucalcin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-601s1c1
Sequence:CCGGGCCTTTGACTATGACCTACAACTCGAGTTGTAGGTCATAGTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-636s1c1
Sequence:CCGGCAACCGCAGAATTGTTTACAACTCGAGTTGTAAACAATTCTGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009060.1-1217s1c1
Sequence:CCGGCCAGAGAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-639s1c1
Sequence:CCGGCCGCAGAATTGTTTACAAGATCTCGAGATCTTGTAAACAATTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-182s1c1
Sequence:CCGGAGATTATTTGTCGATGGGATACTCGAGTATCCCATCGACAAATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009060
RGN MISSION shRNA shRNA Plasmid DNA
regucalcin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-601s1c1
Sequence:CCGGGCCTTTGACTATGACCTACAACTCGAGTTGTAGGTCATAGTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-636s1c1
Sequence:CCGGCAACCGCAGAATTGTTTACAACTCGAGTTGTAAACAATTCTGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009060.1-1217s1c1
Sequence:CCGGCCAGAGAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-639s1c1
Sequence:CCGGCCGCAGAATTGTTTACAAGATCTCGAGATCTTGTAAACAATTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-182s1c1
Sequence:CCGGAGATTATTTGTCGATGGGATACTCGAGTATCCCATCGACAAATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009060
RGN MISSION shRNA Lentiviral Transduction Particles
regucalcin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-601s1c1
Sequence:CCGGGCCTTTGACTATGACCTACAACTCGAGTTGTAGGTCATAGTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-636s1c1
Sequence:CCGGCAACCGCAGAATTGTTTACAACTCGAGTTGTAAACAATTCTGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009060.1-1217s1c1
Sequence:CCGGCCAGAGAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-639s1c1
Sequence:CCGGCCGCAGAATTGTTTACAAGATCTCGAGATCTTGTAAACAATTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009060.1-182s1c1
Sequence:CCGGAGATTATTTGTCGATGGGATACTCGAGTATCCCATCGACAAATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)