EMAIL THIS PAGE TO A FRIEND

RGP1

RGP1 retrograde golgi transport homolog (S. cerevisiae)

75 Gene Product Result for
Synonyms: KIAA0258
UniProtKB ID: Q92546, Q5TCV5
Gene ID:
Mouse(242406) RGP1 retrograde golgi transport homolog (S. cerevisiae)
Rat(313493) RGP1 retrograde golgi transport homolog (S. cerevisiae)
cow(539393) RGP1 retrograde golgi transport homolog (S. cerevisiae)
sheep(101113727) RGP1 retrograde golgi transport homolog (S. cerevisiae)
domestic guinea pig(100731470) RGP1 retrograde golgi transport homolog (S. cerevisiae)
naked mole-rat(101719375) RGP1 retrograde golgi transport homolog (S. cerevisiae)
Thale Cress(821233) reversibly glycosylated polypeptide 1
Zebrafish(436881) RGP1 retrograde golgi transport homolog (S. cerevisiae)
chicken(431658) RGP1 retrograde golgi transport homolog (S. cerevisiae)
domestic cat(101093809) RGP1 retrograde golgi transport homolog (S. cerevisiae)
Horse(100067753) RGP1 retrograde golgi transport homolog (S. cerevisiae)
dog(100684169) RGP1 retrograde golgi transport homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080496 Rosetta Predictions human pricing
XM_376830 Rosetta Predictions human pricing
XM_933756 Rosetta Predictions human pricing
XM_001063666 Rosetta Predictions rat pricing
XM_233379 Rosetta Predictions rat pricing
NM_172866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315405 predicted 434
2 SASI_Hs02_00315406 predicted 500
3 SASI_Hs02_00315407 predicted 577
4 SASI_Hs02_00315408 predicted 745
5 SASI_Hs02_00315409 predicted 503
6 SASI_Hs02_00315410 predicted 788
7 SASI_Hs02_00315411 predicted 989
8 SASI_Hs02_00315412 predicted 990
9 SASI_Hs02_00315413 predicted 534
10 SASI_Hs02_00315414 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260517 predicted 425
2 SASI_Hs01_00260518 predicted 489
3 SASI_Hs01_00260519 predicted 573
4 SASI_Hs01_00260520 predicted 740
5 SASI_Hs01_00260521 predicted 493
6 SASI_Hs01_00260522 predicted 779
7 SASI_Hs01_00260523 predicted 973
8 SASI_Hs01_00260524 predicted 257
9 SASI_Hs01_00260525 predicted 978
10 SASI_Hs01_00260526 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290423 predicted 893
2 SASI_Hs01_00290424 predicted 912
3 SASI_Hs01_00290425 predicted 992
4 SASI_Hs01_00290426 predicted 843
5 SASI_Hs01_00290427 predicted 867
6 SASI_Hs01_00290428 predicted 631
7 SASI_Hs01_00290429 predicted 708
8 SASI_Hs01_00290430 predicted 565
9 SASI_Hs01_00290431 predicted 472
10 SASI_Hs01_00290432 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307953 predicted 644
2 SASI_Rn02_00307954 predicted 1133
3 SASI_Rn02_00307955 predicted 1315
4 SASI_Rn02_00307956 predicted 1220
5 SASI_Rn02_00307957 predicted 1407
6 SASI_Rn02_00307958 predicted 675
7 SASI_Rn02_00307959 predicted 1420
8 SASI_Rn02_00307960 predicted 413
9 SASI_Rn02_00307961 predicted 721
10 SASI_Rn02_00307962 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387722 predicted 643
2 SASI_Rn02_00387723 predicted 1132
3 SASI_Rn02_00387724 predicted 1318
4 SASI_Rn02_00387725 predicted 1214
5 SASI_Rn02_00387726 predicted 1407
6 SASI_Rn02_00387727 predicted 677
7 SASI_Rn02_00387728 predicted 1417
8 SASI_Rn02_00387729 predicted 412
9 SASI_Rn02_00387730 predicted 721
10 SASI_Rn02_00387731 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344827 predicted 677
2 SASI_Mm01_00095501 predicted 1336
3 SASI_Mm02_00344828 predicted 347
4 SASI_Mm01_00095502 predicted 1580
5 SASI_Mm01_00095503 predicted 1241
6 SASI_Mm01_00095505 predicted 1668
7 SASI_Mm02_00344829 predicted 1786
8 SASI_Mm01_00095506 predicted 1440
9 SASI_Mm01_00095508 predicted 1239
10 SASI_Mm01_00095509 predicted 963
11 SASI_Mm01_00095504 predicted 366
12 SASI_Mm01_00095507 predicted 1191
13 SASI_Mm01_00095510 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080496
RGP1 MISSION shRNA Bacterial Glycerol Stock
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-987s21c1
Sequence:CCGGCCAGGAATCCTGCCTACATACCTCGAGGTATGTAGGCAGGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-77s21c1
Sequence:CCGGCGATCCCTAGTGTCGACTATGCTCGAGCATAGTCGACACTAGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-791s21c1
Sequence:CCGGGGACGTTTGGCATCTTCAAATCTCGAGATTTGAAGATGCCAAACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-435s21c1
Sequence:CCGGTGATCCTGGAGAGTCCAAATCCTCGAGGATTTGGACTCTCCAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-1077s21c1
Sequence:CCGGCTTGAAGTGGAGATTGCATTTCTCGAGAAATGCAATCTCCACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080496
RGP1 MISSION shRNA shRNA Plasmid DNA
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-987s21c1
Sequence:CCGGCCAGGAATCCTGCCTACATACCTCGAGGTATGTAGGCAGGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-77s21c1
Sequence:CCGGCGATCCCTAGTGTCGACTATGCTCGAGCATAGTCGACACTAGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-791s21c1
Sequence:CCGGGGACGTTTGGCATCTTCAAATCTCGAGATTTGAAGATGCCAAACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-435s21c1
Sequence:CCGGTGATCCTGGAGAGTCCAAATCCTCGAGGATTTGGACTCTCCAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-1077s21c1
Sequence:CCGGCTTGAAGTGGAGATTGCATTTCTCGAGAAATGCAATCTCCACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080496
RGP1 MISSION shRNA Lentiviral Transduction Particles
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-987s21c1
Sequence:CCGGCCAGGAATCCTGCCTACATACCTCGAGGTATGTAGGCAGGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-77s21c1
Sequence:CCGGCGATCCCTAGTGTCGACTATGCTCGAGCATAGTCGACACTAGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-791s21c1
Sequence:CCGGGGACGTTTGGCATCTTCAAATCTCGAGATTTGAAGATGCCAAACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-435s21c1
Sequence:CCGGTGATCCTGGAGAGTCCAAATCCTCGAGGATTTGGACTCTCCAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080496.1-1077s21c1
Sequence:CCGGCTTGAAGTGGAGATTGCATTTCTCGAGAAATGCAATCTCCACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172866
VALIDATED
RGP1 MISSION shRNA Bacterial Glycerol Stock
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-401s1c1
Sequence:CCGGCAAATCATATTCCTACAGTGACTCGAGTCACTGTAGGAATATGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-461s1c1
Sequence:CCGGGTCAGTCAAATATGTCTACAACTCGAGTTGTAGACATATTTGACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-697s1c1
Sequence:CCGGGCAGCCTCCATCTGTACAATACTCGAGTATTGTACAGATGGAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-1050s1c1
Sequence:CCGGGAATTTGTAACATCCCGAGAACTCGAGTTCTCGGGATGTTACAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172866
VALIDATED
RGP1 MISSION shRNA shRNA Plasmid DNA
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-401s1c1
Sequence:CCGGCAAATCATATTCCTACAGTGACTCGAGTCACTGTAGGAATATGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-461s1c1
Sequence:CCGGGTCAGTCAAATATGTCTACAACTCGAGTTGTAGACATATTTGACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-697s1c1
Sequence:CCGGGCAGCCTCCATCTGTACAATACTCGAGTATTGTACAGATGGAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-1050s1c1
Sequence:CCGGGAATTTGTAACATCCCGAGAACTCGAGTTCTCGGGATGTTACAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172866
VALIDATED
RGP1 MISSION shRNA Lentiviral Transduction Particles
RGP1 retrograde golgi transport homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-401s1c1
Sequence:CCGGCAAATCATATTCCTACAGTGACTCGAGTCACTGTAGGAATATGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-461s1c1
Sequence:CCGGGTCAGTCAAATATGTCTACAACTCGAGTTGTAGACATATTTGACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172866.1-697s1c1
Sequence:CCGGGCAGCCTCCATCTGTACAATACTCGAGTATTGTACAGATGGAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172866.1-1050s1c1
Sequence:CCGGGAATTTGTAACATCCCGAGAACTCGAGTTCTCGGGATGTTACAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)