EMAIL THIS PAGE TO A FRIEND

RGPD2

RANBP2-like and GRIP domain containing 2

26 Gene Product Result for
Synonyms: NUP358 RANBP2L2 RGP2
Species: Human RGPD2(729857)
UniProtKB ID: P0DJD1, P0C839, Q68DN6, Q6V1X0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001078170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078170 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078170 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313270 predicted 2799
2 SASI_Hs02_00313271 predicted 2498
3 SASI_Hs02_00313272 predicted 2336
4 SASI_Hs02_00313273 predicted 1974
5 SASI_Hs02_00313274 predicted 1000
6 SASI_Hs02_00313275 predicted 1895
7 SASI_Hs02_00313276 predicted 1724
8 SASI_Hs02_00313277 predicted 683
9 SASI_Hs02_00313278 predicted 1908
10 SASI_Hs02_00313279 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078170
RGPD2 MISSION shRNA Bacterial Glycerol Stock
RANBP2-like and GRIP domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1424s21c1
Sequence:CCGGAGCGGTTGGCAGCACAATTTACTCGAGTAAATTGTGCTGCCAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-344s21c1
Sequence:CCGGCTACACCATCTCCTACCAAATCTCGAGATTTGGTAGGAGATGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1290s21c1
Sequence:CCGGGCGAAGAGACCAAGTACTAAACTCGAGTTTAGTACTTGGTCTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078170.1-3318s21c1
Sequence:CCGGTAGTTGAACATCGACATCAAACTCGAGTTTGATGTCGATGTTCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1493s21c1
Sequence:CCGGAGCGGCTTCTGTTAGACATACCTCGAGGTATGTCTAACAGAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078170
RGPD2 MISSION shRNA shRNA Plasmid DNA
RANBP2-like and GRIP domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1424s21c1
Sequence:CCGGAGCGGTTGGCAGCACAATTTACTCGAGTAAATTGTGCTGCCAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-344s21c1
Sequence:CCGGCTACACCATCTCCTACCAAATCTCGAGATTTGGTAGGAGATGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1290s21c1
Sequence:CCGGGCGAAGAGACCAAGTACTAAACTCGAGTTTAGTACTTGGTCTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078170.1-3318s21c1
Sequence:CCGGTAGTTGAACATCGACATCAAACTCGAGTTTGATGTCGATGTTCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1493s21c1
Sequence:CCGGAGCGGCTTCTGTTAGACATACCTCGAGGTATGTCTAACAGAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078170
RGPD2 MISSION shRNA Lentiviral Transduction Particles
RANBP2-like and GRIP domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1424s21c1
Sequence:CCGGAGCGGTTGGCAGCACAATTTACTCGAGTAAATTGTGCTGCCAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-344s21c1
Sequence:CCGGCTACACCATCTCCTACCAAATCTCGAGATTTGGTAGGAGATGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1290s21c1
Sequence:CCGGGCGAAGAGACCAAGTACTAAACTCGAGTTTAGTACTTGGTCTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078170.1-3318s21c1
Sequence:CCGGTAGTTGAACATCGACATCAAACTCGAGTTTGATGTCGATGTTCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078170.1-1493s21c1
Sequence:CCGGAGCGGCTTCTGTTAGACATACCTCGAGGTATGTCTAACAGAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)