EMAIL THIS PAGE TO A FRIEND

RGPD3

RANBP2-like and GRIP domain containing 3

69 Gene Product Result for
Synonyms: RGP3
Species: Human RGPD3(653489)
UniProtKB ID: A6NKT7, B8ZZM4
Gene ID:
Human(653489) Summary: This gene is located in a cluster of Ran-binding protein related genes on chromosome 2 which arose through duplication in primates. The encoded protein contains an N-terminal TPR (tetratricopeptide repeat) domain, two Ran-binding domains, and a C-terminal GRIP domain (golgin-97, RanBP2alpha, Imh1p and p230/golgin-245) domain. [provided by RefSeq, Sep 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_929931 Rosetta Predictions human pricing
XM_934100 Rosetta Predictions human pricing
XM_934103 Rosetta Predictions human pricing
XM_934105 Rosetta Predictions human pricing
XM_934108 Rosetta Predictions human pricing
XM_934110 Rosetta Predictions human pricing
XM_934113 Rosetta Predictions human pricing
XM_934115 Rosetta Predictions human pricing
XM_934118 Rosetta Predictions human pricing
XM_934121 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277652 predicted 1038
2 SASI_Hs02_00481189 predicted 5439
3 SASI_Hs01_00277653 predicted 5152
4 SASI_Hs01_00277654 predicted 4994
5 SASI_Hs01_00277655 predicted 388
6 SASI_Hs01_00277656 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274257 predicted 348
2 SASI_Hs01_00274258 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280436 predicted 5192
2 SASI_Hs01_00280437 predicted 4893
3 SASI_Hs01_00280438 predicted 4909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296474 predicted 2215
2 SASI_Hs01_00296475 predicted 4275
3 SASI_Hs01_00296476 predicted 3897
4 SASI_Hs01_00296477 predicted 4474
5 SASI_Hs01_00296478 predicted 3243
6 SASI_Hs01_00296479 predicted 3738
7 SASI_Hs01_00296480 predicted 2226
8 SASI_Hs01_00296481 predicted 3283
9 SASI_Hs01_00296482 predicted 3118
10 SASI_Hs01_00296483 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290245 predicted 3814
2 SASI_Hs01_00290246 predicted 5872
3 SASI_Hs01_00290247 predicted 5492
4 SASI_Hs01_00290248 predicted 6074
5 SASI_Hs01_00290249 predicted 4835
6 SASI_Hs01_00290250 predicted 5333
7 SASI_Hs01_00290251 predicted 4924
8 SASI_Hs01_00290252 predicted 3824
9 SASI_Hs01_00290253 predicted 4887
10 SASI_Hs01_00290254 predicted 4710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283499 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255932 predicted 2840
2 SASI_Hs01_00255933 predicted 4896
3 SASI_Hs01_00255934 predicted 4519
4 SASI_Hs01_00255935 predicted 5101
5 SASI_Hs01_00255936 predicted 3863
6 SASI_Hs01_00255937 predicted 4356
7 SASI_Hs01_00255938 predicted 2860
8 SASI_Hs01_00255939 predicted 3911
9 SASI_Hs01_00255940 predicted 3744
10 SASI_Hs01_00255941 predicted 2701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290817 predicted 2841
2 SASI_Hs01_00290818 predicted 4899
3 SASI_Hs01_00290819 predicted 4517
4 SASI_Hs01_00290820 predicted 5098
5 SASI_Hs01_00290821 predicted 3861
6 SASI_Hs01_00290822 predicted 4358
7 SASI_Hs01_00290823 predicted 2858
8 SASI_Hs01_00290824 predicted 3915
9 SASI_Hs01_00290825 predicted 3744
10 SASI_Hs01_00290826 predicted 2699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266782 predicted 5081
2 SASI_Hs01_00266783 predicted 3290
3 SASI_Hs01_00266784 predicted 4930
4 SASI_Hs01_00266785 predicted 349
5 SASI_Hs01_00266786 predicted 3791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251019 predicted 2426
2 SASI_Hs01_00251020 predicted 4480
3 SASI_Hs01_00251021 predicted 4107
4 SASI_Hs01_00251022 predicted 4689
5 SASI_Hs01_00251023 predicted 3447
6 SASI_Hs01_00251024 predicted 3945
7 SASI_Hs01_00251025 predicted 2442
8 SASI_Hs01_00251026 predicted 3503
9 SASI_Hs01_00251027 predicted 3332
10 SASI_Hs01_00251028 predicted 2289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144013
RGPD3 MISSION shRNA Bacterial Glycerol Stock
RANBP2-like and GRIP domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-306s21c1
Sequence:CCGGCAGGCGTTCAGTGGAATTAAACTCGAGTTTAATTCCACTGAACGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2224s21c1
Sequence:CCGGTTAGATGACAGTGATTCAAATCTCGAGATTTGAATCACTGTCATCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2506s21c1
Sequence:CCGGCAAGAAGTAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144013.1-5449s21c1
Sequence:CCGGTCATGTGTATTACCATCATTCCTCGAGGAATGATGGTAATACACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-131s21c1
Sequence:CCGGAGTCAACGAGAGGATTCTATTCTCGAGAATAGAATCCTCTCGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144013
RGPD3 MISSION shRNA shRNA Plasmid DNA
RANBP2-like and GRIP domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-306s21c1
Sequence:CCGGCAGGCGTTCAGTGGAATTAAACTCGAGTTTAATTCCACTGAACGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2224s21c1
Sequence:CCGGTTAGATGACAGTGATTCAAATCTCGAGATTTGAATCACTGTCATCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2506s21c1
Sequence:CCGGCAAGAAGTAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144013.1-5449s21c1
Sequence:CCGGTCATGTGTATTACCATCATTCCTCGAGGAATGATGGTAATACACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-131s21c1
Sequence:CCGGAGTCAACGAGAGGATTCTATTCTCGAGAATAGAATCCTCTCGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144013
RGPD3 MISSION shRNA Lentiviral Transduction Particles
RANBP2-like and GRIP domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-306s21c1
Sequence:CCGGCAGGCGTTCAGTGGAATTAAACTCGAGTTTAATTCCACTGAACGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2224s21c1
Sequence:CCGGTTAGATGACAGTGATTCAAATCTCGAGATTTGAATCACTGTCATCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-2506s21c1
Sequence:CCGGCAAGAAGTAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144013.1-5449s21c1
Sequence:CCGGTCATGTGTATTACCATCATTCCTCGAGGAATGATGGTAATACACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144013.1-131s21c1
Sequence:CCGGAGTCAACGAGAGGATTCTATTCTCGAGAATAGAATCCTCTCGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)