EMAIL THIS PAGE TO A FRIEND

RGPD5

RANBP2-like and GRIP domain containing 5

115 Gene Product Result for
Synonyms: BS-63 BS63 RGP5
Species: Human RGPD5(84220)
UniProtKB ID: Q99666, Q53QN2, Q53T03, Q59GM7, Q9H0B2
Gene ID:
Human(84220) Summary: RAN is a small GTP-binding protein of the RAS superfamily that is associated with the nuclear membrane and is thought to control a variety of cellular functions through its interactions with other proteins. This gene shares a high degree of sequence identity with RANBP2, a large RAN-binding protein localized at the cytoplasmic side of the nuclear pore complex. It is believed that this RANBP2 gene family member arose from a duplication event 3 Mb distal to RANBP2. Alternative splicing has been observed for this locus and two variants are described. Additional splicing is suggested but complete sequence for further transcripts has not been determined. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005054 Rosetta Predictions human pricing
NM_032260 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338865 predicted 2191
2 SASI_Hs02_00338866 predicted 150
3 SASI_Hs02_00338867 predicted 5424
4 SASI_Hs01_00012512 predicted 2519
5 SASI_Hs02_00338868 predicted 5469
6 SASI_Hs02_00338869 predicted 2522
7 SASI_Hs02_00338870 predicted 2494
8 SASI_Hs01_00012504 predicted 809
9 SASI_Hs01_00012505 predicted 3088
10 SASI_Hs01_00012506 predicted 782
11 SASI_Hs01_00012507 predicted 2454
12 SASI_Hs01_00012508 predicted 787
13 SASI_Hs01_00012509 predicted 805
14 SASI_Hs01_00012510 predicted 704
15 SASI_Hs01_00012511 predicted 2934
16 SASI_Hs01_00012513 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230628 predicted 2652
2 SASI_Hs01_00230629 predicted 2950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005054
RGPD5 MISSION shRNA Bacterial Glycerol Stock
RANBP2-like and GRIP domain containing 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6481s1c1
Sequence:CCGGCCGTGCTACATCTTCACAGTTCTCGAGAACTGTGAAGATGTAGCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-2718s1c1
Sequence:CCGGCCAGCATATAATTCCCAGTATCTCGAGATACTGGGAATTATATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-1230s1c1
Sequence:CCGGGCGTTATATGATGCTCTGTTTCTCGAGAAACAGAGCATCATATAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-669s1c1
Sequence:CCGGCGTTCAAGTTTAGAGTGGAATCTCGAGATTCCACTCTAAACTTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6874s1c1
Sequence:CCGGGCCGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-2521s1c1
Sequence:CCGGGCCAACAAGTAGAGGCCATTACTCGAGTAATGGCCTCTACTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-5094s1c1
Sequence:CCGGCGGGAAATAGAGGCAACCAATCTCGAGATTGGTTGCCTCTATTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-453s21c1
Sequence:CCGCCCAGGAAGTCCTGCAATTTATCTCGAGATAAATTGCAGGACTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005054.2-5464s21c1
Sequence:CCGGGTTCGTGTGTGTTACCATTATCTCGAGATAATGGTAACACACACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-2237s21c1
Sequence:CCGGGATTATAGATGACGGTGATTCCTCGAGGAATCACCGTCATCTATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005054
RGPD5 MISSION shRNA shRNA Plasmid DNA
RANBP2-like and GRIP domain containing 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6481s1c1
Sequence:CCGGCCGTGCTACATCTTCACAGTTCTCGAGAACTGTGAAGATGTAGCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-2718s1c1
Sequence:CCGGCCAGCATATAATTCCCAGTATCTCGAGATACTGGGAATTATATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-1230s1c1
Sequence:CCGGGCGTTATATGATGCTCTGTTTCTCGAGAAACAGAGCATCATATAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-669s1c1
Sequence:CCGGCGTTCAAGTTTAGAGTGGAATCTCGAGATTCCACTCTAAACTTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6874s1c1
Sequence:CCGGGCCGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-2521s1c1
Sequence:CCGGGCCAACAAGTAGAGGCCATTACTCGAGTAATGGCCTCTACTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-5094s1c1
Sequence:CCGGCGGGAAATAGAGGCAACCAATCTCGAGATTGGTTGCCTCTATTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-453s21c1
Sequence:CCGCCCAGGAAGTCCTGCAATTTATCTCGAGATAAATTGCAGGACTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005054.2-5464s21c1
Sequence:CCGGGTTCGTGTGTGTTACCATTATCTCGAGATAATGGTAACACACACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-2237s21c1
Sequence:CCGGGATTATAGATGACGGTGATTCCTCGAGGAATCACCGTCATCTATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005054
RGPD5 MISSION shRNA Lentiviral Transduction Particles
RANBP2-like and GRIP domain containing 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6481s1c1
Sequence:CCGGCCGTGCTACATCTTCACAGTTCTCGAGAACTGTGAAGATGTAGCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-2718s1c1
Sequence:CCGGCCAGCATATAATTCCCAGTATCTCGAGATACTGGGAATTATATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-1230s1c1
Sequence:CCGGGCGTTATATGATGCTCTGTTTCTCGAGAAACAGAGCATCATATAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-669s1c1
Sequence:CCGGCGTTCAAGTTTAGAGTGGAATCTCGAGATTCCACTCTAAACTTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005054.1-6874s1c1
Sequence:CCGGGCCGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005054.1-2521s1c1
Sequence:CCGGGCCAACAAGTAGAGGCCATTACTCGAGTAATGGCCTCTACTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005054.1-5094s1c1
Sequence:CCGGCGGGAAATAGAGGCAACCAATCTCGAGATTGGTTGCCTCTATTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-453s21c1
Sequence:CCGCCCAGGAAGTCCTGCAATTTATCTCGAGATAAATTGCAGGACTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005054.2-5464s21c1
Sequence:CCGGGTTCGTGTGTGTTACCATTATCTCGAGATAATGGTAACACACACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005054.2-2237s21c1
Sequence:CCGGGATTATAGATGACGGTGATTCCTCGAGGAATCACCGTCATCTATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)