EMAIL THIS PAGE TO A FRIEND

RGS10

regulator of G-protein signaling 10

76 Gene Product Result for
UniProtKB ID: O43665, A8K408, B1AMR8, Q6IAZ6, Q96GN0
Gene ID:
Human(6001) Summary: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 10 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. This protein associates specifically with the activated forms of the two related G-protein subunits, G-alphai3 and G-alphaz but fails to interact with the structurally and functionally distinct G-alpha subunits. Regulator of G protein signaling 10 protein is localized in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67865) regulator of G-protein signalling 10
Rat(54290) regulator of G-protein signaling 10
naked mole-rat(101718163) regulator of G-protein signaling 10
domestic guinea pig(100716128) regulator of G-protein signaling 10
cow(614550) regulator of G-protein signaling 10
sheep(101107650) regulator of G-protein signaling 10
chicken(423930) regulator of G-protein signaling 10
dog(477840) regulator of G-protein signaling 10
domestic cat(101089300) regulator of G-protein signaling 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005339 Rosetta Predictions human pricing
NM_002925 Rosetta Predictions human pricing
NM_019337 Rosetta Predictions rat pricing
NM_026418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189918 predicted 459
2 SASI_Hs01_00189919 predicted 493
3 SASI_Hs02_00304852 predicted 637
4 SASI_Hs01_00189920 predicted 661
5 SASI_Hs01_00189921 predicted 374
6 SASI_Hs01_00189922 predicted 553
7 SASI_Hs01_00189923 predicted 422
8 SASI_Hs01_00189925 predicted 399
9 SASI_Hs02_00304853 predicted 402
10 SASI_Hs01_00189926 predicted 337
11 SASI_Hs01_00189924 predicted 680
12 SASI_Hs01_00189927 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060950 predicted 405
2 SASI_Hs01_00060951 predicted 442
3 SASI_Hs02_00334755 predicted 582
4 SASI_Hs01_00060952 predicted 612
5 SASI_Hs01_00060953 predicted 317
6 SASI_Hs01_00060954 predicted 504
7 SASI_Hs01_00060955 predicted 375
8 SASI_Hs01_00060957 predicted 348
9 SASI_Hs02_00334756 predicted 357
10 SASI_Hs01_00060958 predicted 284
11 SASI_Hs01_00060956 predicted 626
12 SASI_Hs01_00060959 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262321 predicted 532
2 SASI_Rn02_00262322 predicted 592
3 SASI_Rn02_00262323 predicted 445
4 SASI_Rn02_00262324 predicted 405
5 SASI_Rn02_00262325 predicted 437
6 SASI_Rn02_00262326 predicted 229
7 SASI_Rn02_00262327 predicted 273
8 SASI_Rn02_00262328 predicted 529
9 SASI_Rn02_00262329 predicted 299
10 SASI_Rn02_00262330 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184353 predicted 246
2 SASI_Mm01_00184355 predicted 628
3 SASI_Mm01_00184356 predicted 385
4 SASI_Mm01_00184357 predicted 243
5 SASI_Mm01_00184358 predicted 444
6 SASI_Mm01_00184359 predicted 479
7 SASI_Mm01_00184360 predicted 274
8 SASI_Mm01_00184361 predicted 344
9 SASI_Mm02_00330226 predicted 384
10 SASI_Mm01_00184362 predicted 578
11 SASI_Mm01_00184354 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002925
VALIDATED
RGS10 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-499s1c1
Sequence:CCGGTGATGCTCAAACTGCAGCTAACTCGAGTTAGCTGCAGTTTGAGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002925.3-649s21c1
Sequence:CCGGTTATTTGTAAGGACTGAAATGCTCGAGCATTTCAGTCCTTACAAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-432s1c1
Sequence:CCGGGCCGCTTTCTTAAGTCTGACTCTCGAGAGTCAGACTTAAGAAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-389s1c1
Sequence:CCGGCTCCAGGACCAGATCTTTAATCTCGAGATTAAAGATCTGGTCCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-367s1c1
Sequence:CCGGGCACCCTCTGATGTTCCAGAACTCGAGTTCTGGAACATCAGAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-241s1c1
Sequence:CCGGGCAAGATAAGACGCAGATGCACTCGAGTGCATCTGCGTCTTATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-231s21c1
Sequence:CCGGTTGGCTAGCATGTGAAGATTTCTCGAGAAATCTTCACATGCTAGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-160s21c1
Sequence:CCGGGAAGACCCAGAAGGCGTGAAACTCGAGTTTCACGCCTTCTGGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-114s21c1
Sequence:CCGGCCTCAAGAGCACAGCCAAATGCTCGAGCATTTGGCTGTGCTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002925
VALIDATED
RGS10 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-499s1c1
Sequence:CCGGTGATGCTCAAACTGCAGCTAACTCGAGTTAGCTGCAGTTTGAGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002925.3-649s21c1
Sequence:CCGGTTATTTGTAAGGACTGAAATGCTCGAGCATTTCAGTCCTTACAAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-432s1c1
Sequence:CCGGGCCGCTTTCTTAAGTCTGACTCTCGAGAGTCAGACTTAAGAAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-389s1c1
Sequence:CCGGCTCCAGGACCAGATCTTTAATCTCGAGATTAAAGATCTGGTCCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-367s1c1
Sequence:CCGGGCACCCTCTGATGTTCCAGAACTCGAGTTCTGGAACATCAGAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-241s1c1
Sequence:CCGGGCAAGATAAGACGCAGATGCACTCGAGTGCATCTGCGTCTTATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-231s21c1
Sequence:CCGGTTGGCTAGCATGTGAAGATTTCTCGAGAAATCTTCACATGCTAGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-160s21c1
Sequence:CCGGGAAGACCCAGAAGGCGTGAAACTCGAGTTTCACGCCTTCTGGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-114s21c1
Sequence:CCGGCCTCAAGAGCACAGCCAAATGCTCGAGCATTTGGCTGTGCTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002925
VALIDATED
RGS10 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-499s1c1
Sequence:CCGGTGATGCTCAAACTGCAGCTAACTCGAGTTAGCTGCAGTTTGAGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002925.3-649s21c1
Sequence:CCGGTTATTTGTAAGGACTGAAATGCTCGAGCATTTCAGTCCTTACAAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-432s1c1
Sequence:CCGGGCCGCTTTCTTAAGTCTGACTCTCGAGAGTCAGACTTAAGAAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-389s1c1
Sequence:CCGGCTCCAGGACCAGATCTTTAATCTCGAGATTAAAGATCTGGTCCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-367s1c1
Sequence:CCGGGCACCCTCTGATGTTCCAGAACTCGAGTTCTGGAACATCAGAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002925.2-241s1c1
Sequence:CCGGGCAAGATAAGACGCAGATGCACTCGAGTGCATCTGCGTCTTATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-231s21c1
Sequence:CCGGTTGGCTAGCATGTGAAGATTTCTCGAGAAATCTTCACATGCTAGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-160s21c1
Sequence:CCGGGAAGACCCAGAAGGCGTGAAACTCGAGTTTCACGCCTTCTGGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002925.3-114s21c1
Sequence:CCGGCCTCAAGAGCACAGCCAAATGCTCGAGCATTTGGCTGTGCTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026418
VALIDATED
RGS10 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-660s1c1
Sequence:CCGGCTGTCATTTCTTTGTTGTGTTCTCGAGAACACAACAAAGAAATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-338s1c1
Sequence:CCGGCTACATGACCTTCCTGTCCAACTCGAGTTGGACAGGAAGGTCATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-494s1c1
Sequence:CCGGCTTCTTGAAGTCTGACTTGTTCTCGAGAACAAGTCAGACTTCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-583s1c1
Sequence:CCGGCCTCCAGAATTTACAACACATCTCGAGATGTGTTGTAAATTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-248s1c1
Sequence:CCGGCAGCGAAGAGAATGTCTTGTTCTCGAGAACAAGACATTCTCTTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-105s21c1
Sequence:CCGGCTGATATCCATGACGGAGATGCTCGAGCATCTCCGTCATGGATATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026418.2-699s21c1
Sequence:CCGGGACCTTCCCTCTGGATATGTGCTCGAGCACATATCCAGAGGGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-445s21c1
Sequence:CCGGGCTCCAGGACCAGATCTTCAACTCGAGTTGAAGATCTGGTCCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-423s21c1
Sequence:CCGGCACACCCTCTGATGTTCCAAACTCGAGTTTGGAACATCAGAGGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026418
VALIDATED
RGS10 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-660s1c1
Sequence:CCGGCTGTCATTTCTTTGTTGTGTTCTCGAGAACACAACAAAGAAATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-338s1c1
Sequence:CCGGCTACATGACCTTCCTGTCCAACTCGAGTTGGACAGGAAGGTCATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-494s1c1
Sequence:CCGGCTTCTTGAAGTCTGACTTGTTCTCGAGAACAAGTCAGACTTCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-583s1c1
Sequence:CCGGCCTCCAGAATTTACAACACATCTCGAGATGTGTTGTAAATTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-248s1c1
Sequence:CCGGCAGCGAAGAGAATGTCTTGTTCTCGAGAACAAGACATTCTCTTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-105s21c1
Sequence:CCGGCTGATATCCATGACGGAGATGCTCGAGCATCTCCGTCATGGATATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026418.2-699s21c1
Sequence:CCGGGACCTTCCCTCTGGATATGTGCTCGAGCACATATCCAGAGGGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-445s21c1
Sequence:CCGGGCTCCAGGACCAGATCTTCAACTCGAGTTGAAGATCTGGTCCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-423s21c1
Sequence:CCGGCACACCCTCTGATGTTCCAAACTCGAGTTTGGAACATCAGAGGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026418
VALIDATED
RGS10 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-660s1c1
Sequence:CCGGCTGTCATTTCTTTGTTGTGTTCTCGAGAACACAACAAAGAAATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-338s1c1
Sequence:CCGGCTACATGACCTTCCTGTCCAACTCGAGTTGGACAGGAAGGTCATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-494s1c1
Sequence:CCGGCTTCTTGAAGTCTGACTTGTTCTCGAGAACAAGTCAGACTTCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-583s1c1
Sequence:CCGGCCTCCAGAATTTACAACACATCTCGAGATGTGTTGTAAATTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026418.1-248s1c1
Sequence:CCGGCAGCGAAGAGAATGTCTTGTTCTCGAGAACAAGACATTCTCTTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-105s21c1
Sequence:CCGGCTGATATCCATGACGGAGATGCTCGAGCATCTCCGTCATGGATATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026418.2-699s21c1
Sequence:CCGGGACCTTCCCTCTGGATATGTGCTCGAGCACATATCCAGAGGGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-445s21c1
Sequence:CCGGGCTCCAGGACCAGATCTTCAACTCGAGTTGAAGATCTGGTCCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026418.2-423s21c1
Sequence:CCGGCACACCCTCTGATGTTCCAAACTCGAGTTTGGAACATCAGAGGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)