EMAIL THIS PAGE TO A FRIEND

RGS12

regulator of G-protein signaling 12

143 Gene Product Result for
Gene ID:
Human(6002) Summary: This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71729) regulator of G-protein signaling 12
Rat(54292) regulator of G-protein signaling 12
naked mole-rat(101726381) regulator of G-protein signaling 12
domestic guinea pig(100713051) regulator of G-protein signaling 12
cow(505477) regulator of G-protein signaling 12
sheep(101121937) regulator of G-protein signaling 12
chicken(395619) regulator of G-protein signaling 12
domestic cat(101086970) regulator of G-protein signaling 12
Horse(100053871) regulator of G-protein signaling 12
dog(608720) regulator of G-protein signaling 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002926 Rosetta Predictions human pricing
NM_198227 Rosetta Predictions human pricing
NM_198229 Rosetta Predictions human pricing
NM_198230 Rosetta Predictions human pricing
NM_198430 Rosetta Predictions human pricing
NM_198432 Rosetta Predictions human pricing
NM_198587 Rosetta Predictions human pricing
NM_019339 Rosetta Predictions rat pricing
NM_173402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196671 predicted 3996
2 SASI_Hs01_00196672 predicted 3999
3 SASI_Hs01_00196673 predicted 3350
4 SASI_Hs01_00196674 predicted 3295
5 SASI_Hs01_00196675 predicted 3466
6 SASI_Hs01_00196676 predicted 3967
7 SASI_Hs01_00196677 predicted 3396
8 SASI_Hs01_00196678 predicted 3859
9 SASI_Hs01_00196679 predicted 4010
10 SASI_Hs01_00196680 predicted 3785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246961 predicted 1419
2 SASI_Hs01_00246962 predicted 1415
3 SASI_Hs01_00246963 predicted 777
4 SASI_Hs01_00246964 predicted 720
5 SASI_Hs01_00246966 predicted 893
6 SASI_Hs01_00246967 predicted 1397
7 SASI_Hs01_00246968 predicted 823
8 SASI_Hs01_00246969 predicted 1276
9 SASI_Hs01_00246970 predicted 1432
10 SASI_Hs02_00371757 predicted 1204
11 SASI_Hs01_00246965 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096664 predicted 3995
2 SASI_Hs01_00096665 predicted 3994
3 SASI_Hs01_00096666 predicted 3351
4 SASI_Hs01_00096667 predicted 3299
5 SASI_Hs01_00096668 predicted 3471
6 SASI_Hs01_00096669 predicted 3969
7 SASI_Hs01_00096670 predicted 3396
8 SASI_Hs01_00096671 predicted 3852
9 SASI_Hs01_00096672 predicted 4012
10 SASI_Hs01_00096673 predicted 3782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232697 predicted 2060
2 SASI_Hs01_00232698 predicted 2049
3 SASI_Hs01_00232699 predicted 1413
4 SASI_Hs01_00232700 predicted 1896
5 SASI_Hs01_00232701 predicted 1531
6 SASI_Hs01_00232702 predicted 2025
7 SASI_Hs01_00232703 predicted 1463
8 SASI_Hs01_00232704 predicted 1912
9 SASI_Hs01_00232705 predicted 2063
10 SASI_Hs01_00232706 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011878 predicted 1169
2 SASI_Hs01_00011879 predicted 1173
3 SASI_Hs01_00011880 predicted 520
4 SASI_Hs01_00011881 predicted 470
5 SASI_Hs01_00011882 predicted 1013
6 SASI_Hs01_00011883 predicted 647
7 SASI_Hs01_00011884 predicted 1141
8 SASI_Hs01_00011885 predicted 573
9 SASI_Hs01_00011886 predicted 1025
10 SASI_Hs01_00011887 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021070 predicted 1088
2 SASI_Hs01_00021071 predicted 1592
3 SASI_Hs01_00021072 predicted 1275
4 SASI_Hs01_00021073 predicted 1722
5 SASI_Hs01_00021074 predicted 1932
6 SASI_Hs01_00021075 predicted 2360
7 SASI_Hs01_00021076 predicted 1201
8 SASI_Hs01_00021077 predicted 1138
9 SASI_Hs01_00021078 predicted 1097
10 SASI_Hs01_00021079 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127415 predicted 1381
2 SASI_Hs01_00127416 predicted 1371
3 SASI_Hs01_00127417 predicted 729
4 SASI_Hs01_00127418 predicted 679
5 SASI_Hs01_00127419 predicted 1220
6 SASI_Hs01_00127420 predicted 853
7 SASI_Hs01_00127421 predicted 1355
8 SASI_Hs01_00127422 predicted 777
9 SASI_Hs01_00127423 predicted 1233
10 SASI_Hs01_00127424 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031476 predicted 2963
2 SASI_Rn01_00031477 predicted 680
3 SASI_Rn02_00262331 predicted 615
4 SASI_Rn01_00031478 predicted 2348
5 SASI_Rn01_00031479 predicted 2679
6 SASI_Rn01_00031480 predicted 689
7 SASI_Rn01_00031481 predicted 834
8 SASI_Rn01_00031482 predicted 316
9 SASI_Rn01_00031483 predicted 1124
10 SASI_Rn01_00031484 predicted 825
11 SASI_Rn01_00031485 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095571 predicted 3123
2 SASI_Mm01_00095572 predicted 2584
3 SASI_Mm01_00095573 predicted 2424
4 SASI_Mm01_00095574 predicted 1197
5 SASI_Mm01_00095575 predicted 1836
6 SASI_Mm01_00095576 predicted 823
7 SASI_Mm01_00095577 predicted 2177
8 SASI_Mm01_00095579 predicted 747
9 SASI_Mm01_00095580 predicted 2211
10 SASI_Mm02_00345260 predicted 2604
11 SASI_Mm01_00095578 predicted 2484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002926
RGS12 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-2834s21c1
Sequence:CCGGACGTCTGCTCGGAGATCATTTCTCGAGAAATGATCTCCGAGCAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-4326s21c1
Sequence:CCGGGAACACTAGGCAAGTCTAATTCTCGAGAATTAGACTTGCCTAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2761s1c1
Sequence:CCGGCGAAAGACTAAGGAAGATAAACTCGAGTTTATCTTCCTTAGTCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4011s1c1
Sequence:CCGGGCTGGATCTTGTTCCGATTAACTCGAGTTAATCGGAACAAGATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002926.2-5984s1c1
Sequence:CCGGCGTCTGTAGATCTGTACATATCTCGAGATATGTACAGATCTACAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2719s1c1
Sequence:CCGGGCCTTTGGAATGCAAAGCATTCTCGAGAATGCTTTGCATTCCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4390s1c1
Sequence:CCGGCGGCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002926
RGS12 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-2834s21c1
Sequence:CCGGACGTCTGCTCGGAGATCATTTCTCGAGAAATGATCTCCGAGCAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-4326s21c1
Sequence:CCGGGAACACTAGGCAAGTCTAATTCTCGAGAATTAGACTTGCCTAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2761s1c1
Sequence:CCGGCGAAAGACTAAGGAAGATAAACTCGAGTTTATCTTCCTTAGTCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4011s1c1
Sequence:CCGGGCTGGATCTTGTTCCGATTAACTCGAGTTAATCGGAACAAGATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002926.2-5984s1c1
Sequence:CCGGCGTCTGTAGATCTGTACATATCTCGAGATATGTACAGATCTACAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2719s1c1
Sequence:CCGGGCCTTTGGAATGCAAAGCATTCTCGAGAATGCTTTGCATTCCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4390s1c1
Sequence:CCGGCGGCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002926
RGS12 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-2834s21c1
Sequence:CCGGACGTCTGCTCGGAGATCATTTCTCGAGAAATGATCTCCGAGCAGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002926.3-4326s21c1
Sequence:CCGGGAACACTAGGCAAGTCTAATTCTCGAGAATTAGACTTGCCTAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2761s1c1
Sequence:CCGGCGAAAGACTAAGGAAGATAAACTCGAGTTTATCTTCCTTAGTCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4011s1c1
Sequence:CCGGGCTGGATCTTGTTCCGATTAACTCGAGTTAATCGGAACAAGATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002926.2-5984s1c1
Sequence:CCGGCGTCTGTAGATCTGTACATATCTCGAGATATGTACAGATCTACAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-2719s1c1
Sequence:CCGGGCCTTTGGAATGCAAAGCATTCTCGAGAATGCTTTGCATTCCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002926.2-4390s1c1
Sequence:CCGGCGGCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173402
VALIDATED
RGS12 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-3663s21c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-829s21c1
Sequence:CCGGTTGGACTAGATGCGAGTATTTCTCGAGAAATACTCGCATCTAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-3605s21c1
Sequence:CCGGAGGCAAGTCTAACTCTATTAACTCGAGTTAATAGAGTTAGACTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-857s21c1
Sequence:CCGGTGCCATGGTTGTGGGCTATTTCTCGAGAAATAGCCCACAACCATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173402.1-4332s21c1
Sequence:CCGGCTTGACCTGTCCATGATTAATCTCGAGATTAATCATGGACAGGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3663s1c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-917s1c1
Sequence:CCGGGCATGACAGTTTACAGGCTATCTCGAGATAGCCTGTAAACTGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-1992s1c1
Sequence:CCGGGCTTTCGGAATGCAGAACCTTCTCGAGAAGGTTCTGCATTCCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-2122s1c1
Sequence:CCGGCCTTTGGAAGATCTAGGAGATCTCGAGATCTCCTAGATCTTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3270s1c1
Sequence:CCGGCGAACTTTGTTTCGGCTGGATCTCGAGATCCAGCCGAAACAAAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173402
VALIDATED
RGS12 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-3663s21c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-829s21c1
Sequence:CCGGTTGGACTAGATGCGAGTATTTCTCGAGAAATACTCGCATCTAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-3605s21c1
Sequence:CCGGAGGCAAGTCTAACTCTATTAACTCGAGTTAATAGAGTTAGACTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-857s21c1
Sequence:CCGGTGCCATGGTTGTGGGCTATTTCTCGAGAAATAGCCCACAACCATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173402.1-4332s21c1
Sequence:CCGGCTTGACCTGTCCATGATTAATCTCGAGATTAATCATGGACAGGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3663s1c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-917s1c1
Sequence:CCGGGCATGACAGTTTACAGGCTATCTCGAGATAGCCTGTAAACTGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-1992s1c1
Sequence:CCGGGCTTTCGGAATGCAGAACCTTCTCGAGAAGGTTCTGCATTCCGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-2122s1c1
Sequence:CCGGCCTTTGGAAGATCTAGGAGATCTCGAGATCTCCTAGATCTTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3270s1c1
Sequence:CCGGCGAACTTTGTTTCGGCTGGATCTCGAGATCCAGCCGAAACAAAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173402
VALIDATED
RGS12 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-3663s21c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173402.1-829s21c1
Sequence:CCGGTTGGACTAGATGCGAGTATTTCTCGAGAAATACTCGCATCTAGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-3605s21c1
Sequence:CCGGAGGCAAGTCTAACTCTATTAACTCGAGTTAATAGAGTTAGACTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173402.1-857s21c1
Sequence:CCGGTGCCATGGTTGTGGGCTATTTCTCGAGAAATAGCCCACAACCATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173402.1-4332s21c1
Sequence:CCGGCTTGACCTGTCCATGATTAATCTCGAGATTAATCATGGACAGGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3663s1c1
Sequence:CCGGCGCCTTTCAAAGAGAGAAGAACTCGAGTTCTTCTCTCTTTGAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-917s1c1
Sequence:CCGGGCATGACAGTTTACAGGCTATCTCGAGATAGCCTGTAAACTGTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-1992s1c1
Sequence:CCGGGCTTTCGGAATGCAGAACCTTCTCGAGAAGGTTCTGCATTCCGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-2122s1c1
Sequence:CCGGCCTTTGGAAGATCTAGGAGATCTCGAGATCTCCTAGATCTTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173402.1-3270s1c1
Sequence:CCGGCGAACTTTGTTTCGGCTGGATCTCGAGATCCAGCCGAAACAAAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)