EMAIL THIS PAGE TO A FRIEND

RGS16

regulator of G-protein signaling 16

107 Gene Product Result for
Synonyms: A28-RGS14 A28-RGS14P RGS-R
UniProtKB ID: O15492, B2R4M4, Q5VYN9, Q99701
Gene ID:
Human(6004) Summary: The protein encoded by this gene belongs to the 'regulator of G protein signaling' family. It inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits. It also may play a role in regulating the kinetics of signaling in the phototransduction cascade. [provided by RefSeq, Jul 2008]
Mouse(19734) regulator of G-protein signaling 16
Rat(360857) regulator of G-protein signaling 16
Zebrafish(569828) regulator of G-protein signaling 16
domestic cat(101092326) regulator of G-protein signaling 16
chicken(424409) regulator of G-protein signaling 16
dog(100685243) regulator of G-protein signaling 16
cow(282035) regulator of G-protein signaling 16
sheep(101103743) regulator of G-protein signaling 16
domestic guinea pig(100731588) regulator of G-protein signaling 16
naked mole-rat(101723551) regulator of G-protein signaling 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504317 Anti-phospho-RGS16 (pTyr168) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1100495 Anti-RGS16 (131-145) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100494 Anti-RGS16 (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW21321 Anti-RGS16 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
AV34040 Anti-RGS16 antibody produced in rabbit IgG fraction of antiserum dog, rat, pig, mouse, human
immunofluorescence, western blot pricing
HPA053250 Anti-RGS16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA055824 Anti-RGS16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502634 Anti-RGS16 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4100409 Monoclonal Anti-RGS16 antibody produced in mouse clone RGS16-A350, culture supernatant human
western blot pricing
SAB4100422 Monoclonal Anti-RGS16 antibody produced in mouse clone RGS16-B350, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002928 Rosetta Predictions human pricing
NM_001077589 Rosetta Predictions rat pricing
NM_011267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245842 predicted 597
2 SASI_Hs01_00245843 predicted 490
3 SASI_Hs02_00334758 predicted 284
4 SASI_Hs01_00245844 predicted 262
5 SASI_Hs01_00245845 predicted 1176
6 SASI_Hs01_00245846 predicted 1111
7 SASI_Hs01_00245847 predicted 1163
8 SASI_Hs01_00245848 predicted 527
9 SASI_Hs01_00245849 predicted 1092
10 SASI_Hs01_00245851 predicted 1217
11 SASI_Hs01_00245850 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207592 predicted 226
2 SASI_Rn02_00207593 predicted 331
3 SASI_Rn02_00207594 predicted 280
4 SASI_Rn02_00207595 predicted 341
5 SASI_Rn02_00207596 predicted 218
6 SASI_Rn02_00207597 predicted 328
7 SASI_Rn02_00207598 predicted 225
8 SASI_Rn02_00207599 predicted 339
9 SASI_Rn02_00207600 predicted 335
10 SASI_Rn02_00207601 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320286 predicted 292
2 SASI_Mm01_00116082 predicted 1027
3 SASI_Mm01_00116083 predicted 1145
4 SASI_Mm01_00116084 predicted 883
5 SASI_Mm02_00320287 predicted 268
6 SASI_Mm01_00116085 predicted 1145
7 SASI_Mm01_00116086 predicted 289
8 SASI_Mm02_00320288 predicted 559
9 SASI_Mm01_00116090 predicted 902
10 SASI_Mm02_00320289 predicted 247
11 SASI_Mm01_00116087 predicted 998
12 SASI_Mm01_00116088 predicted 1081
13 SASI_Mm01_00116089 predicted 531
14 SASI_Mm01_00116091 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002928
RGS16 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002928.3-452s21c1
Sequence:CCGGGAGTTCAAGAAGATCCGATCACTCGAGTGATCGGATCTTCTTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1103s21c1
Sequence:CCGGTTAGGAAACATGTGGATAAAGCTCGAGCTTTATCCACATGTTTCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002928.2-1387s1c1
Sequence:CCGGGCGAGATATTTATACCTCAAACTCGAGTTTGAGGTATAAATATCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-389s1c1
Sequence:CCGGCGCTTTCCTGAAGACAGAGTTCTCGAGAACTCTGTCTTCAGGAAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-494s1c1
Sequence:CCGGCCAGATCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-658s1c1
Sequence:CCGGGCTTCCTGAAGTCGCCTGCTTCTCGAGAAGCAGGCGACTTCAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1176s21c1
Sequence:CCGGTTGCTCAGTTGACTCTGATTGCTCGAGCAATCAGAGTCAACTGAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002928
RGS16 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002928.3-452s21c1
Sequence:CCGGGAGTTCAAGAAGATCCGATCACTCGAGTGATCGGATCTTCTTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1103s21c1
Sequence:CCGGTTAGGAAACATGTGGATAAAGCTCGAGCTTTATCCACATGTTTCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002928.2-1387s1c1
Sequence:CCGGGCGAGATATTTATACCTCAAACTCGAGTTTGAGGTATAAATATCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-389s1c1
Sequence:CCGGCGCTTTCCTGAAGACAGAGTTCTCGAGAACTCTGTCTTCAGGAAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-494s1c1
Sequence:CCGGCCAGATCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-658s1c1
Sequence:CCGGGCTTCCTGAAGTCGCCTGCTTCTCGAGAAGCAGGCGACTTCAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1176s21c1
Sequence:CCGGTTGCTCAGTTGACTCTGATTGCTCGAGCAATCAGAGTCAACTGAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002928
RGS16 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002928.3-452s21c1
Sequence:CCGGGAGTTCAAGAAGATCCGATCACTCGAGTGATCGGATCTTCTTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1103s21c1
Sequence:CCGGTTAGGAAACATGTGGATAAAGCTCGAGCTTTATCCACATGTTTCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002928.2-1387s1c1
Sequence:CCGGGCGAGATATTTATACCTCAAACTCGAGTTTGAGGTATAAATATCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-389s1c1
Sequence:CCGGCGCTTTCCTGAAGACAGAGTTCTCGAGAACTCTGTCTTCAGGAAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-494s1c1
Sequence:CCGGCCAGATCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002928.2-658s1c1
Sequence:CCGGGCTTCCTGAAGTCGCCTGCTTCTCGAGAAGCAGGCGACTTCAGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002928.3-1176s21c1
Sequence:CCGGTTGCTCAGTTGACTCTGATTGCTCGAGCAATCAGAGTCAACTGAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011267
VALIDATED
RGS16 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011267.1-525s1c1
Sequence:CCGGCCGAGAACTGACCAAGACAAACTCGAGTTTGTCTTGGTCAGTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011267.1-996s1c1
Sequence:CCGGGCCCAGAACTTATACTTTCTACTCGAGTAGAAAGTATAAGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-250s1c1
Sequence:CCGGTGGGCCAGTAAGCATAACAAACTCGAGTTTGTTATGCTTACTGGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-310s1c1
Sequence:CCGGTCTTTCGATTTGCTGCTGAATCTCGAGATTCAGCAGCAAATCGAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-184s1c1
Sequence:CCGGCGGCTGGGAATCTTTCTTCATCTCGAGATGAAGAAAGATTCCCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011267
VALIDATED
RGS16 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011267.1-525s1c1
Sequence:CCGGCCGAGAACTGACCAAGACAAACTCGAGTTTGTCTTGGTCAGTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011267.1-996s1c1
Sequence:CCGGGCCCAGAACTTATACTTTCTACTCGAGTAGAAAGTATAAGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-250s1c1
Sequence:CCGGTGGGCCAGTAAGCATAACAAACTCGAGTTTGTTATGCTTACTGGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-310s1c1
Sequence:CCGGTCTTTCGATTTGCTGCTGAATCTCGAGATTCAGCAGCAAATCGAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-184s1c1
Sequence:CCGGCGGCTGGGAATCTTTCTTCATCTCGAGATGAAGAAAGATTCCCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011267
VALIDATED
RGS16 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011267.1-525s1c1
Sequence:CCGGCCGAGAACTGACCAAGACAAACTCGAGTTTGTCTTGGTCAGTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011267.1-996s1c1
Sequence:CCGGGCCCAGAACTTATACTTTCTACTCGAGTAGAAAGTATAAGTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-250s1c1
Sequence:CCGGTGGGCCAGTAAGCATAACAAACTCGAGTTTGTTATGCTTACTGGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-310s1c1
Sequence:CCGGTCTTTCGATTTGCTGCTGAATCTCGAGATTCAGCAGCAAATCGAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011267.1-184s1c1
Sequence:CCGGCGGCTGGGAATCTTTCTTCATCTCGAGATGAAGAAAGATTCCCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)