EMAIL THIS PAGE TO A FRIEND

RGS18

regulator of G-protein signaling 18

92 Gene Product Result for
Synonyms: RGS13
UniProtKB ID: Q9NS28, B2RD23
Gene ID:
Human(64407) Summary: This gene encodes a member of the regulator of G-protein signaling family. This protein is contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signaling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(64214) regulator of G-protein signaling 18
Rat(289076) regulator of G-protein signaling 18
Zebrafish(768164) regulator of G-protein signaling 18
domestic cat(101089487) regulator of G-protein signaling 18
dog(607858) regulator of G-protein signaling 18
chicken(424361) regulator of G-protein signaling 18
cow(613624) regulator of G-protein signaling 18
sheep(101123221) regulator of G-protein signaling 18
domestic guinea pig(100716189) regulator of G-protein signaling 18
naked mole-rat(101702279) regulator of G-protein signaling 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130782 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024491 MISSION® esiRNA esiRNA human RGS18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130782 Rosetta Predictions human pricing
NM_001047084 Rosetta Predictions rat pricing
NM_022881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186967 predicted 310
2 SASI_Hs02_00362814 predicted 313
3 SASI_Hs01_00186969 predicted 835
4 SASI_Hs01_00186970 predicted 824
5 SASI_Hs01_00186971 predicted 322
6 SASI_Hs02_00362815 predicted 856
7 SASI_Hs01_00186972 predicted 553
8 SASI_Hs01_00186974 predicted 708
9 SASI_Hs01_00186975 predicted 331
10 SASI_Hs01_00186976 predicted 346
11 SASI_Hs01_00186968 predicted 443
12 SASI_Hs01_00186973 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205774 predicted 439
2 SASI_Rn02_00205775 predicted 403
3 SASI_Rn02_00205776 predicted 242
4 SASI_Rn02_00205777 predicted 295
5 SASI_Rn02_00205778 predicted 378
6 SASI_Rn02_00205779 predicted 465
7 SASI_Rn02_00205780 predicted 238
8 SASI_Rn02_00205781 predicted 367
9 SASI_Rn02_00205782 predicted 273
10 SASI_Rn02_00205783 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326663 predicted 909
2 SASI_Mm01_00022785 predicted 652
3 SASI_Mm01_00022787 predicted 415
4 SASI_Mm01_00022788 predicted 727
5 SASI_Mm01_00022789 predicted 858
6 SASI_Mm01_00022790 predicted 314
7 SASI_Mm01_00022792 predicted 598
8 SASI_Mm01_00022793 predicted 938
9 SASI_Mm01_00022794 predicted 310
10 SASI_Mm02_00326664 predicted 435
11 SASI_Mm01_00022786 predicted 442
12 SASI_Mm01_00022791 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022881
RGS18 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-584s1c1
Sequence:CCGGGCAAAGGCAATCTATGAGAAACTCGAGTTTCTCATAGATTGCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-854s1c1
Sequence:CCGGCAAGATGTAAAGTCAGATGTTCTCGAGAACATCTGACTTTACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-408s1c1
Sequence:CCGGCTCCTGAAGAAGCAGTGAAATCTCGAGATTTCACTGCTTCTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-275s1c1
Sequence:CCGGGAAACAAGCATCGAGGCCAAACTCGAGTTTGGCCTCGATGCTTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-737s1c1
Sequence:CCGGCATGACAGTTATAAACGCTTTCTCGAGAAAGCGTTTATAACTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1064s21c1
Sequence:CCGGCATCATCTATCTTCCGAAATACTCGAGTATTTCGGAAGATAGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1194s21c1
Sequence:CCGGAGTAATGTCACATCTAGTTTGCTCGAGCAAACTAGATGTGACATTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1278s21c1
Sequence:CCGGATGATGGATTGAGGCTTATAGCTCGAGCTATAAGCCTCAATCCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-817s21c1
Sequence:CCGGAGGAGACGATCACGATCATTTCTCGAGAAATGATCGTGATCGTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-758s21c1
Sequence:CCGGTGAAATCTGAGACCTACTTACCTCGAGGTAAGTAGGTCTCAGATTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022881
RGS18 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-584s1c1
Sequence:CCGGGCAAAGGCAATCTATGAGAAACTCGAGTTTCTCATAGATTGCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-854s1c1
Sequence:CCGGCAAGATGTAAAGTCAGATGTTCTCGAGAACATCTGACTTTACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-408s1c1
Sequence:CCGGCTCCTGAAGAAGCAGTGAAATCTCGAGATTTCACTGCTTCTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-275s1c1
Sequence:CCGGGAAACAAGCATCGAGGCCAAACTCGAGTTTGGCCTCGATGCTTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-737s1c1
Sequence:CCGGCATGACAGTTATAAACGCTTTCTCGAGAAAGCGTTTATAACTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1064s21c1
Sequence:CCGGCATCATCTATCTTCCGAAATACTCGAGTATTTCGGAAGATAGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1194s21c1
Sequence:CCGGAGTAATGTCACATCTAGTTTGCTCGAGCAAACTAGATGTGACATTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1278s21c1
Sequence:CCGGATGATGGATTGAGGCTTATAGCTCGAGCTATAAGCCTCAATCCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-817s21c1
Sequence:CCGGAGGAGACGATCACGATCATTTCTCGAGAAATGATCGTGATCGTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-758s21c1
Sequence:CCGGTGAAATCTGAGACCTACTTACCTCGAGGTAAGTAGGTCTCAGATTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022881
RGS18 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-584s1c1
Sequence:CCGGGCAAAGGCAATCTATGAGAAACTCGAGTTTCTCATAGATTGCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-854s1c1
Sequence:CCGGCAAGATGTAAAGTCAGATGTTCTCGAGAACATCTGACTTTACATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-408s1c1
Sequence:CCGGCTCCTGAAGAAGCAGTGAAATCTCGAGATTTCACTGCTTCTTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-275s1c1
Sequence:CCGGGAAACAAGCATCGAGGCCAAACTCGAGTTTGGCCTCGATGCTTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022881.2-737s1c1
Sequence:CCGGCATGACAGTTATAAACGCTTTCTCGAGAAAGCGTTTATAACTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1064s21c1
Sequence:CCGGCATCATCTATCTTCCGAAATACTCGAGTATTTCGGAAGATAGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1194s21c1
Sequence:CCGGAGTAATGTCACATCTAGTTTGCTCGAGCAAACTAGATGTGACATTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022881.4-1278s21c1
Sequence:CCGGATGATGGATTGAGGCTTATAGCTCGAGCTATAAGCCTCAATCCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-817s21c1
Sequence:CCGGAGGAGACGATCACGATCATTTCTCGAGAAATGATCGTGATCGTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022881.4-758s21c1
Sequence:CCGGTGAAATCTGAGACCTACTTACCTCGAGGTAAGTAGGTCTCAGATTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130782
RGS18 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-550s1c1
Sequence:CCGGCCTCAACAAATTCACCTTAAACTCGAGTTTAAGGTGAATTTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-421s1c1
Sequence:CCGGGAATCATTTGACAAACTGCTTCTCGAGAAGCAGTTTGTCAAATGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-714s1c1
Sequence:CCGGGCTCATGGAACAAGACAGTTACTCGAGTAACTGTCTTGTTCCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-817s1c1
Sequence:CCGGCGCTCATTTACCTGCAATGAACTCGAGTTCATTGCAGGTAAATGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130782.1-1728s1c1
Sequence:CCGGCGTCTCATGTTTGGCCCTTTACTCGAGTAAAGGGCCAAACATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130782.2-1042s21c1
Sequence:CCGGATACAGTATCTGCCAGTATATCTCGAGATATACTGGCAGATACTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130782.2-789s21c1
Sequence:CCGGAGACCTCAGAGACCAACAAATCTCGAGATTTGTTGGTCTCTGAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130782
RGS18 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-550s1c1
Sequence:CCGGCCTCAACAAATTCACCTTAAACTCGAGTTTAAGGTGAATTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-421s1c1
Sequence:CCGGGAATCATTTGACAAACTGCTTCTCGAGAAGCAGTTTGTCAAATGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-714s1c1
Sequence:CCGGGCTCATGGAACAAGACAGTTACTCGAGTAACTGTCTTGTTCCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-817s1c1
Sequence:CCGGCGCTCATTTACCTGCAATGAACTCGAGTTCATTGCAGGTAAATGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130782.1-1728s1c1
Sequence:CCGGCGTCTCATGTTTGGCCCTTTACTCGAGTAAAGGGCCAAACATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130782.2-1042s21c1
Sequence:CCGGATACAGTATCTGCCAGTATATCTCGAGATATACTGGCAGATACTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130782.2-789s21c1
Sequence:CCGGAGACCTCAGAGACCAACAAATCTCGAGATTTGTTGGTCTCTGAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130782
RGS18 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-550s1c1
Sequence:CCGGCCTCAACAAATTCACCTTAAACTCGAGTTTAAGGTGAATTTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-421s1c1
Sequence:CCGGGAATCATTTGACAAACTGCTTCTCGAGAAGCAGTTTGTCAAATGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-714s1c1
Sequence:CCGGGCTCATGGAACAAGACAGTTACTCGAGTAACTGTCTTGTTCCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130782.1-817s1c1
Sequence:CCGGCGCTCATTTACCTGCAATGAACTCGAGTTCATTGCAGGTAAATGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130782.1-1728s1c1
Sequence:CCGGCGTCTCATGTTTGGCCCTTTACTCGAGTAAAGGGCCAAACATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130782.2-1042s21c1
Sequence:CCGGATACAGTATCTGCCAGTATATCTCGAGATATACTGGCAGATACTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130782.2-789s21c1
Sequence:CCGGAGACCTCAGAGACCAACAAATCTCGAGATTTGTTGGTCTCTGAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)