EMAIL THIS PAGE TO A FRIEND

RGS19

regulator of G-protein signaling 19

55 Gene Product Result for
Synonyms: GAIP RGSGAIP
UniProtKB ID: P49795, A8K216, E1P5G9, Q53XN0, Q8TD60
Gene ID:
Human(10287) Summary: G proteins mediate a number of cellular processes. The protein encoded by this gene belongs to the RGS (regulators of G-protein signaling) family and specifically interacts with G protein, GAI3. This protein is a guanosine triphosphatase-activating protein that functions to down-regulate Galpha i/Galpha q-linked signaling. Alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56470) regulator of G-protein signaling 19
Rat(59293) regulator of G-protein signaling 19
naked mole-rat(101705472) regulator of G-protein signaling 19
domestic guinea pig(100726898) regulator of G-protein signaling 19
cow(539036) regulator of G-protein signaling 19
sheep(101107810) regulator of G-protein signaling 19
Zebrafish(100170801) regulator of G-protein signaling 19
chicken(374070) regulator of G-protein signalling 19
domestic cat(101091098) regulator of G-protein signaling 19
dog(491407) regulator of G-protein signaling 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151971 MISSION® esiRNA esiRNA human RGS19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039467 Rosetta Predictions human pricing
NM_005873 Rosetta Predictions human pricing
NM_021661 Rosetta Predictions rat pricing
NM_026446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147422 predicted 1097
2 SASI_Hs01_00147423 predicted 552
3 SASI_Hs01_00147425 predicted 578
4 SASI_Hs01_00147426 predicted 1099
5 SASI_Hs01_00147427 predicted 554
6 SASI_Hs01_00147428 predicted 1129
7 SASI_Hs01_00147429 predicted 580
8 SASI_Hs01_00147430 predicted 861
9 SASI_Hs01_00147431 predicted 586
10 SASI_Hs02_00308519 predicted 715
11 SASI_Hs01_00147424 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181522 predicted 1190
2 SASI_Hs01_00181523 predicted 657
3 SASI_Hs01_00181525 predicted 678
4 SASI_Hs01_00181526 predicted 1191
5 SASI_Hs01_00181527 predicted 647
6 SASI_Hs01_00181528 predicted 1223
7 SASI_Hs01_00181529 predicted 678
8 SASI_Hs01_00181530 predicted 957
9 SASI_Hs01_00181531 predicted 682
10 SASI_Hs02_00340449 predicted 819
11 SASI_Hs01_00181524 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262669 predicted 602
2 SASI_Rn02_00262670 predicted 601
3 SASI_Rn01_00057792 predicted 335
4 SASI_Rn01_00057794 predicted 684
5 SASI_Rn01_00057795 predicted 452
6 SASI_Rn02_00262671 predicted 463
7 SASI_Rn01_00057796 predicted 556
8 SASI_Rn01_00057797 predicted 996
9 SASI_Rn01_00057798 predicted 767
10 SASI_Rn01_00057800 predicted 687
11 SASI_Rn01_00057791 predicted 688
12 SASI_Rn01_00057793 predicted 945
13 SASI_Rn01_00057799 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330277 predicted 1124
2 SASI_Mm01_00077738 predicted 539
3 SASI_Mm01_00077739 predicted 1054
4 SASI_Mm01_00077740 predicted 438
5 SASI_Mm01_00077742 predicted 1003
6 SASI_Mm01_00077744 predicted 1163
7 SASI_Mm01_00077745 predicted 765
8 SASI_Mm01_00077746 predicted 931
9 SASI_Mm01_00077747 predicted 387
10 SASI_Mm02_00330278 predicted 782
11 SASI_Mm01_00077741 predicted 832
12 SASI_Mm01_00077743 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005873
VALIDATED
RGS19 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005873.1-506s1c1
Sequence:CCGGGTGAAGTATGTGCCACGCCAACTCGAGTTGGCGTGGCACATACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005873.1-705s1c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-624s1c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-348s1c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-831s1c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-810s21c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-327s21c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-603s21c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-684s21c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-1390s21c1
Sequence:CCGGCAGAACCTCAGAACCAGATTTCTCGAGAAATCTGGTTCTGAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005873
VALIDATED
RGS19 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005873.1-506s1c1
Sequence:CCGGGTGAAGTATGTGCCACGCCAACTCGAGTTGGCGTGGCACATACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005873.1-705s1c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-624s1c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-348s1c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-831s1c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-810s21c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-327s21c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-603s21c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-684s21c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-1390s21c1
Sequence:CCGGCAGAACCTCAGAACCAGATTTCTCGAGAAATCTGGTTCTGAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005873
VALIDATED
RGS19 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005873.1-506s1c1
Sequence:CCGGGTGAAGTATGTGCCACGCCAACTCGAGTTGGCGTGGCACATACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005873.1-705s1c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-624s1c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-348s1c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005873.1-831s1c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-810s21c1
Sequence:CCGGGCTGCAGATCTACACGCTCATCTCGAGATGAGCGTGTAGATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-327s21c1
Sequence:CCGGCCCTTCAATGTCCAGTCATGACTCGAGTCATGACTGGACATTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-603s21c1
Sequence:CCGGCAGCGAGGAGAACATGCTCTTCTCGAGAAGAGCATGTTCTCCTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-684s21c1
Sequence:CCGGGAGGCTCATCTACGAGGACTACTCGAGTAGTCCTCGTAGATGAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005873.2-1390s21c1
Sequence:CCGGCAGAACCTCAGAACCAGATTTCTCGAGAAATCTGGTTCTGAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026446
VALIDATED
RGS19 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 19
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-694s21c1
Sequence:CCGGACTCGTACCCTCGATTCCTTACTCGAGTAAGGAATCGAGGGTACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-181s1c1
Sequence:CCGGCCTCCCTCGATGTCCAGCCATCTCGAGATGGCTGGACATCGAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026446.2-602s1c1
Sequence:CCGGGTGTGCGAGAAGGCATCAATACTCGAGTATTGATGCCTTCTCGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-540s1c1
Sequence:CCGGGCGACTTATCTATGAGGACTACTCGAGTAGTCCTCATAGATAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-637s1c1
Sequence:CCGGCCATCGCCACACACATTTGATCTCGAGATCAAATGTGTGTGGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-423s1c1
Sequence:CCGGCCGCAGTGTATTCCGGGCATTCTCGAGAATGCCCGGAATACACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-994s21c1
Sequence:CCGGCTCAGAGTCAGACTCATATAACTCGAGTTATATGAGTCTGACTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026446.3-296s21c1
Sequence:CCGGTTGGCAGGTTTCTCGGGAAAGCTCGAGCTTTCCCGAGAAACCTGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-484s21c1
Sequence:CCGGTGGCTTGTGAGGAGTTGAAAGCTCGAGCTTTCAACTCCTCACAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-529s21c1
Sequence:CCGGACGAGAAGGCGCGACTTATCTCTCGAGAGATAAGTCGCGCCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-720s21c1
Sequence:CCGGCCCACCTACCGCTCTCTATTACTCGAGTAATAGAGAGCGGTAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026446.3-860s21c1
Sequence:CCGGTGGCAACTGCAGGGTTCTAAGCTCGAGCTTAGAACCCTGCAGTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026446
VALIDATED
RGS19 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 19
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-694s21c1
Sequence:CCGGACTCGTACCCTCGATTCCTTACTCGAGTAAGGAATCGAGGGTACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-181s1c1
Sequence:CCGGCCTCCCTCGATGTCCAGCCATCTCGAGATGGCTGGACATCGAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026446.2-602s1c1
Sequence:CCGGGTGTGCGAGAAGGCATCAATACTCGAGTATTGATGCCTTCTCGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-540s1c1
Sequence:CCGGGCGACTTATCTATGAGGACTACTCGAGTAGTCCTCATAGATAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-637s1c1
Sequence:CCGGCCATCGCCACACACATTTGATCTCGAGATCAAATGTGTGTGGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-423s1c1
Sequence:CCGGCCGCAGTGTATTCCGGGCATTCTCGAGAATGCCCGGAATACACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-994s21c1
Sequence:CCGGCTCAGAGTCAGACTCATATAACTCGAGTTATATGAGTCTGACTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026446.3-296s21c1
Sequence:CCGGTTGGCAGGTTTCTCGGGAAAGCTCGAGCTTTCCCGAGAAACCTGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-484s21c1
Sequence:CCGGTGGCTTGTGAGGAGTTGAAAGCTCGAGCTTTCAACTCCTCACAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-529s21c1
Sequence:CCGGACGAGAAGGCGCGACTTATCTCTCGAGAGATAAGTCGCGCCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-720s21c1
Sequence:CCGGCCCACCTACCGCTCTCTATTACTCGAGTAATAGAGAGCGGTAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026446.3-860s21c1
Sequence:CCGGTGGCAACTGCAGGGTTCTAAGCTCGAGCTTAGAACCCTGCAGTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026446
VALIDATED
RGS19 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 19
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-694s21c1
Sequence:CCGGACTCGTACCCTCGATTCCTTACTCGAGTAAGGAATCGAGGGTACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-181s1c1
Sequence:CCGGCCTCCCTCGATGTCCAGCCATCTCGAGATGGCTGGACATCGAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026446.2-602s1c1
Sequence:CCGGGTGTGCGAGAAGGCATCAATACTCGAGTATTGATGCCTTCTCGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-540s1c1
Sequence:CCGGGCGACTTATCTATGAGGACTACTCGAGTAGTCCTCATAGATAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-637s1c1
Sequence:CCGGCCATCGCCACACACATTTGATCTCGAGATCAAATGTGTGTGGCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026446.2-423s1c1
Sequence:CCGGCCGCAGTGTATTCCGGGCATTCTCGAGAATGCCCGGAATACACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-994s21c1
Sequence:CCGGCTCAGAGTCAGACTCATATAACTCGAGTTATATGAGTCTGACTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026446.3-296s21c1
Sequence:CCGGTTGGCAGGTTTCTCGGGAAAGCTCGAGCTTTCCCGAGAAACCTGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-484s21c1
Sequence:CCGGTGGCTTGTGAGGAGTTGAAAGCTCGAGCTTTCAACTCCTCACAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-529s21c1
Sequence:CCGGACGAGAAGGCGCGACTTATCTCTCGAGAGATAAGTCGCGCCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026446.3-720s21c1
Sequence:CCGGCCCACCTACCGCTCTCTATTACTCGAGTAATAGAGAGCGGTAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026446.3-860s21c1
Sequence:CCGGTGGCAACTGCAGGGTTCTAAGCTCGAGCTTAGAACCCTGCAGTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)