EMAIL THIS PAGE TO A FRIEND

RGS1

regulator of G-protein signaling 1

79 Gene Product Result for
Synonyms: 1R20 BL34 IER1 IR20
UniProtKB ID: Q08116, B2RDM9, B4DZY0, Q07918, Q9H1W2
Gene ID:
Human(5996) Summary: This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
Mouse(50778) regulator of G-protein signaling 1
Rat(54289) regulator of G-protein signaling 1
Thale Cress(822207) putative membrane receptor protein RGS1
Zebrafish(556179) regulator of G-protein signaling 1
Horse(100034151) regulator of G-protein signaling 1
domestic cat(101088975) regulator of G-protein signaling 1
dog(488585) regulator of G-protein signaling 1
chicken(424360) regulator of G-protein signaling 1
cow(540836) regulator of G-protein signaling 1
sheep(101122711) regulator of G-protein signaling 1
domestic guinea pig(100715338) regulator of G-protein signaling 1
naked mole-rat(101701218) regulator of G-protein signaling 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002922 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002922 Rosetta Predictions human pricing
NM_019336 Rosetta Predictions rat pricing
NM_015811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334751 predicted 451
2 SASI_Hs01_00037729 predicted 408
3 SASI_Hs01_00037730 predicted 348
4 SASI_Hs01_00037731 predicted 673
5 SASI_Hs01_00037732 predicted 293
6 SASI_Hs01_00037733 predicted 198
7 SASI_Hs02_00334752 predicted 201
8 SASI_Hs01_00037735 predicted 284
9 SASI_Hs01_00037736 predicted 490
10 SASI_Hs01_00037737 predicted 263
11 SASI_Hs01_00037734 predicted 488
12 SASI_Hs01_00037738 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109174 predicted 609
2 SASI_Rn01_00109175 predicted 434
3 SASI_Rn01_00109176 predicted 208
4 SASI_Rn01_00109177 predicted 200
5 SASI_Rn01_00109178 predicted 399
6 SASI_Rn02_00262320 predicted 453
7 SASI_Rn01_00109179 predicted 582
8 SASI_Rn01_00109181 predicted 488
9 SASI_Rn01_00109182 predicted 287
10 SASI_Rn01_00109183 predicted 200
11 SASI_Rn01_00109180 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197393 predicted 747
2 SASI_Mm01_00197394 predicted 839
3 SASI_Mm01_00197395 predicted 548
4 SASI_Mm02_00323202 predicted 835
5 SASI_Mm01_00197396 predicted 346
6 SASI_Mm01_00197398 predicted 659
7 SASI_Mm02_00323203 predicted 919
8 SASI_Mm01_00197399 predicted 625
9 SASI_Mm01_00197401 predicted 706
10 SASI_Mm01_00197402 predicted 664
11 SASI_Mm01_00197397 predicted 918
12 SASI_Mm01_00197400 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015811
RGS1 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-560s1c1
Sequence:CCGGCCCAGGTTCCTGAAATCAAATCTCGAGATTTGATTTCAGGAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-88s1c1
Sequence:CCGGCCATTCTCTTCTAGACGACAACTCGAGTTGTCGTCTAGAAGAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-385s1c1
Sequence:CCGGGCATAACAAAGCAGAGAATATCTCGAGATATTCTCTGCTTTGTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-201s1c1
Sequence:CCGGCCAAGTCCAAAGACATACTTTCTCGAGAAAGTATGTCTTTGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-343s21c1
Sequence:CCGGGTTGGCTTGTGAGGACTATAACTCGAGTTATAGTCCTCACAAGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-602s21c1
Sequence:GTACCGGGACCTTCAGGCAAATACTTTACTCGAGTAAAGTATTTGCCTGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-89s21c1
Sequence:GTACCGGCATTCTCTTCTAGACGACAAACTCGAGTTTGTCGTCTAGAAGAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015811.1-826s21c1
Sequence:CCGGCCAATGGAAGGAGATACTATGCTCGAGCATAGTATCTCCTTCCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-202s21c1
Sequence:CCGGCAAGTCCAAAGACATACTTTCCTCGAGGAAAGTATGTCTTTGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015811
RGS1 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-560s1c1
Sequence:CCGGCCCAGGTTCCTGAAATCAAATCTCGAGATTTGATTTCAGGAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-88s1c1
Sequence:CCGGCCATTCTCTTCTAGACGACAACTCGAGTTGTCGTCTAGAAGAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-385s1c1
Sequence:CCGGGCATAACAAAGCAGAGAATATCTCGAGATATTCTCTGCTTTGTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-201s1c1
Sequence:CCGGCCAAGTCCAAAGACATACTTTCTCGAGAAAGTATGTCTTTGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-343s21c1
Sequence:CCGGGTTGGCTTGTGAGGACTATAACTCGAGTTATAGTCCTCACAAGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-602s21c1
Sequence:GTACCGGGACCTTCAGGCAAATACTTTACTCGAGTAAAGTATTTGCCTGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-89s21c1
Sequence:GTACCGGCATTCTCTTCTAGACGACAAACTCGAGTTTGTCGTCTAGAAGAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015811.1-826s21c1
Sequence:CCGGCCAATGGAAGGAGATACTATGCTCGAGCATAGTATCTCCTTCCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-202s21c1
Sequence:CCGGCAAGTCCAAAGACATACTTTCCTCGAGGAAAGTATGTCTTTGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015811
RGS1 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-560s1c1
Sequence:CCGGCCCAGGTTCCTGAAATCAAATCTCGAGATTTGATTTCAGGAACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-88s1c1
Sequence:CCGGCCATTCTCTTCTAGACGACAACTCGAGTTGTCGTCTAGAAGAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-385s1c1
Sequence:CCGGGCATAACAAAGCAGAGAATATCTCGAGATATTCTCTGCTTTGTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015811.1-201s1c1
Sequence:CCGGCCAAGTCCAAAGACATACTTTCTCGAGAAAGTATGTCTTTGGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-343s21c1
Sequence:CCGGGTTGGCTTGTGAGGACTATAACTCGAGTTATAGTCCTCACAAGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-602s21c1
Sequence:GTACCGGGACCTTCAGGCAAATACTTTACTCGAGTAAAGTATTTGCCTGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-89s21c1
Sequence:GTACCGGCATTCTCTTCTAGACGACAAACTCGAGTTTGTCGTCTAGAAGAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015811.1-826s21c1
Sequence:CCGGCCAATGGAAGGAGATACTATGCTCGAGCATAGTATCTCCTTCCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015811.1-202s21c1
Sequence:CCGGCAAGTCCAAAGACATACTTTCCTCGAGGAAAGTATGTCTTTGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002922
RGS1 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-347s1c1
Sequence:CCGGGCTTGTGAAGACTATAAGAAACTCGAGTTTCTTATAGTCTTCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-477s1c1
Sequence:CCGGCCAAGAAGATTAAAGCACCAACTCGAGTTGGTGCTTTAATCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-385s1c1
Sequence:CCGGGCCCTGTAAAGCAGAAGAGATCTCGAGATCTCTTCTGCTTTACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-604s1c1
Sequence:CCGGCCTGCAGGCTAATAGCCTAAACTCGAGTTTAGGCTATTAGCCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-201s1c1
Sequence:CCGGCCAAGTCCAAGGATGTACTTTCTCGAGAAAGTACATCCTTGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-623s21c1
Sequence:CCGGCTTATCCCAGGTTCCTCAAATCTCGAGATTTGAGGAACCTGGGATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-712s21c1
Sequence:CCGGAGGGAATTAACAGATAGTATCCTCGAGGATACTATCTGTTAATTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1146s21c1
Sequence:CCGGACTATTGCTTGTCGGTGTTATCTCGAGATAACACCGACAAGCAATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1093s21c1
Sequence:CCGGGAGCTATTGAAGTCCCATTAACTCGAGTTAATGGGACTTCAATAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-141s21c1
Sequence:CCGGATTGAAAGGAACCACTCATTCCTCGAGGAATGAGTGGTTCCTTTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002922
RGS1 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-347s1c1
Sequence:CCGGGCTTGTGAAGACTATAAGAAACTCGAGTTTCTTATAGTCTTCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-477s1c1
Sequence:CCGGCCAAGAAGATTAAAGCACCAACTCGAGTTGGTGCTTTAATCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-385s1c1
Sequence:CCGGGCCCTGTAAAGCAGAAGAGATCTCGAGATCTCTTCTGCTTTACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-604s1c1
Sequence:CCGGCCTGCAGGCTAATAGCCTAAACTCGAGTTTAGGCTATTAGCCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-201s1c1
Sequence:CCGGCCAAGTCCAAGGATGTACTTTCTCGAGAAAGTACATCCTTGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-623s21c1
Sequence:CCGGCTTATCCCAGGTTCCTCAAATCTCGAGATTTGAGGAACCTGGGATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-712s21c1
Sequence:CCGGAGGGAATTAACAGATAGTATCCTCGAGGATACTATCTGTTAATTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1146s21c1
Sequence:CCGGACTATTGCTTGTCGGTGTTATCTCGAGATAACACCGACAAGCAATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1093s21c1
Sequence:CCGGGAGCTATTGAAGTCCCATTAACTCGAGTTAATGGGACTTCAATAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-141s21c1
Sequence:CCGGATTGAAAGGAACCACTCATTCCTCGAGGAATGAGTGGTTCCTTTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002922
RGS1 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-347s1c1
Sequence:CCGGGCTTGTGAAGACTATAAGAAACTCGAGTTTCTTATAGTCTTCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-477s1c1
Sequence:CCGGCCAAGAAGATTAAAGCACCAACTCGAGTTGGTGCTTTAATCTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-385s1c1
Sequence:CCGGGCCCTGTAAAGCAGAAGAGATCTCGAGATCTCTTCTGCTTTACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-604s1c1
Sequence:CCGGCCTGCAGGCTAATAGCCTAAACTCGAGTTTAGGCTATTAGCCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002922.2-201s1c1
Sequence:CCGGCCAAGTCCAAGGATGTACTTTCTCGAGAAAGTACATCCTTGGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-623s21c1
Sequence:CCGGCTTATCCCAGGTTCCTCAAATCTCGAGATTTGAGGAACCTGGGATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-712s21c1
Sequence:CCGGAGGGAATTAACAGATAGTATCCTCGAGGATACTATCTGTTAATTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1146s21c1
Sequence:CCGGACTATTGCTTGTCGGTGTTATCTCGAGATAACACCGACAAGCAATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002922.3-1093s21c1
Sequence:CCGGGAGCTATTGAAGTCCCATTAACTCGAGTTAATGGGACTTCAATAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002922.3-141s21c1
Sequence:CCGGATTGAAAGGAACCACTCATTCCTCGAGGAATGAGTGGTTCCTTTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)