EMAIL THIS PAGE TO A FRIEND

RGS2

regulator of G-protein signaling 2, 24kDa

63 Gene Product Result for
Synonyms: G0S8
UniProtKB ID: P41220, Q6I9U5
Gene ID:
Human(5997) Summary: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]
Mouse(19735) regulator of G-protein signaling 2
Rat(84583) regulator of G-protein signaling 2
Zebrafish(436935) regulator of G-protein signaling 2
Horse(100051067) regulator of G-protein signaling 2, 24kDa
domestic cat(101088456) regulator of G-protein signaling 2, 24kDa
chicken(378912) regulator of G-protein signaling 2, 24kDa
dog(488584) regulator of G-protein signaling 2, 24kDa
cow(513055) regulator of G-protein signaling 2, 24kDa
sheep(443163) regulator of G-protein signaling 2, 24kDa
domestic guinea pig(100714786) regulator of G-protein signaling 2, 24kDa
naked mole-rat(101699901) regulator of G-protein signaling 2, 24kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002923 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155031 MISSION® esiRNA esiRNA human RGS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002923 Rosetta Predictions human pricing
NM_053453 Rosetta Predictions rat pricing
NM_009061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126554 predicted 291
2 SASI_Hs01_00126555 predicted 553
3 SASI_Hs01_00126556 predicted 678
4 SASI_Hs01_00126557 predicted 517
5 SASI_Hs01_00126558 predicted 941
6 SASI_Hs02_00334753 predicted 949
7 SASI_Hs01_00126559 predicted 570
8 SASI_Hs02_00334754 predicted 825
9 SASI_Hs01_00126561 predicted 782
10 SASI_Hs01_00126563 predicted 806
11 SASI_Hs01_00126560 predicted 739
12 SASI_Hs01_00126562 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266023 predicted 332
2 SASI_Rn02_00266024 predicted 432
3 SASI_Rn02_00266025 predicted 404
4 SASI_Rn01_00098453 predicted 275
5 SASI_Rn02_00266026 predicted 236
6 SASI_Rn01_00098456 predicted 264
7 SASI_Rn02_00266027 predicted 302
8 SASI_Rn02_00266028 predicted 331
9 SASI_Rn02_00266029 predicted 362
10 SASI_Rn02_00266030 predicted 428
11 SASI_Rn01_00098451 predicted 987
12 SASI_Rn01_00098452 predicted 448
13 SASI_Rn01_00098454 predicted 1100
14 SASI_Rn01_00098455 predicted 1141
15 SASI_Rn01_00098457 predicted 360
16 SASI_Rn01_00098458 predicted 1120
17 SASI_Rn01_00098459 predicted 972
18 SASI_Rn01_00098460 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052882 predicted 483
2 SASI_Mm01_00052883 predicted 963
3 SASI_Mm01_00052884 predicted 996
4 SASI_Mm01_00052885 predicted 1151
5 SASI_Mm01_00052886 predicted 472
6 SASI_Mm01_00052887 predicted 285
7 SASI_Mm01_00052888 predicted 1053
8 SASI_Mm01_00052889 predicted 1031
9 SASI_Mm01_00052890 predicted 235
10 SASI_Mm01_00052891 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009061
RGS2 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 2, 24kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-138s1c1
Sequence:CCGGGACACTCTTAAAGGATTGGAACTCGAGTTCCAATCCTTTAAGAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-592s1c1
Sequence:CCGGCCTCGGTTCTTGGAGTCCGAACTCGAGTTCGGACTCCAAGAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-438s1c1
Sequence:CCGGCTATACCGACTTCATAGAGAACTCGAGTTCTCTATGAAGTCGGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-60s1c1
Sequence:CCGGCCAGCACGACTGCGTACCCATCTCGAGATGGGTACGCAGTCGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-268s1c1
Sequence:CCGGCTCTGGGCAGAAGCATTTGATCTCGAGATCAAATGCTTCTGCCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-472s1c1
Sequence:CCGGGAGATAAACATAGACTTCCAACTCGAGTTGGAAGTCTATGTTTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-463s1c1
Sequence:CCGGGCTCCCAAAGAGATAAACATACTCGAGTATGTTTATCTCTTTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-579s1c1
Sequence:CCGGGAACAATTCTTATCCTCGGTTCTCGAGAACCGAGGATAAGAATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-606s1c1
Sequence:CCGGGTCCGAATTCTACCAGGACTTCTCGAGAAGTCCTGGTAGAATTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009061
RGS2 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 2, 24kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-138s1c1
Sequence:CCGGGACACTCTTAAAGGATTGGAACTCGAGTTCCAATCCTTTAAGAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-592s1c1
Sequence:CCGGCCTCGGTTCTTGGAGTCCGAACTCGAGTTCGGACTCCAAGAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-438s1c1
Sequence:CCGGCTATACCGACTTCATAGAGAACTCGAGTTCTCTATGAAGTCGGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-60s1c1
Sequence:CCGGCCAGCACGACTGCGTACCCATCTCGAGATGGGTACGCAGTCGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-268s1c1
Sequence:CCGGCTCTGGGCAGAAGCATTTGATCTCGAGATCAAATGCTTCTGCCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-472s1c1
Sequence:CCGGGAGATAAACATAGACTTCCAACTCGAGTTGGAAGTCTATGTTTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-463s1c1
Sequence:CCGGGCTCCCAAAGAGATAAACATACTCGAGTATGTTTATCTCTTTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-579s1c1
Sequence:CCGGGAACAATTCTTATCCTCGGTTCTCGAGAACCGAGGATAAGAATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-606s1c1
Sequence:CCGGGTCCGAATTCTACCAGGACTTCTCGAGAAGTCCTGGTAGAATTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009061
RGS2 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 2, 24kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-138s1c1
Sequence:CCGGGACACTCTTAAAGGATTGGAACTCGAGTTCCAATCCTTTAAGAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-592s1c1
Sequence:CCGGCCTCGGTTCTTGGAGTCCGAACTCGAGTTCGGACTCCAAGAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-438s1c1
Sequence:CCGGCTATACCGACTTCATAGAGAACTCGAGTTCTCTATGAAGTCGGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-60s1c1
Sequence:CCGGCCAGCACGACTGCGTACCCATCTCGAGATGGGTACGCAGTCGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-268s1c1
Sequence:CCGGCTCTGGGCAGAAGCATTTGATCTCGAGATCAAATGCTTCTGCCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-472s1c1
Sequence:CCGGGAGATAAACATAGACTTCCAACTCGAGTTGGAAGTCTATGTTTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-463s1c1
Sequence:CCGGGCTCCCAAAGAGATAAACATACTCGAGTATGTTTATCTCTTTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-579s1c1
Sequence:CCGGGAACAATTCTTATCCTCGGTTCTCGAGAACCGAGGATAAGAATTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009061.2-606s1c1
Sequence:CCGGGTCCGAATTCTACCAGGACTTCTCGAGAAGTCCTGGTAGAATTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002923
VALIDATED
RGS2 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 2, 24kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-508s1c1
Sequence:CCGGCCCAGAATATACAAGAAGCTACTCGAGTAGCTTCTTGTATATTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-158s1c1
Sequence:CCGGGACCCGTTTGAGCTACTTCTTCTCGAGAAGAAGTAGCTCAAACGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-510s1c1
Sequence:CCGGCAGAATATACAAGAAGCTACACTCGAGTGTAGCTTCTTGTATATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002923.2-159s21c1
Sequence:CCGGCCCGTTTGAGCTACTTCTTACCTCGAGGTAAGAAGTAGCTCAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-569s21c1
Sequence:CCGGTTGATGGAGAACAACTCTTATCTCGAGATAAGAGTTGTTCTCCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-611s21c1
Sequence:CCGGTTCTACCAGGACTTGTGTAAACTCGAGTTTACACAAGTCCTGGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-650s21c1
Sequence:CCGGGAGCCTCATGCTACATGAAATCTCGAGATTTCATGTAGCATGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002923.2-1247s21c1
Sequence:CCGGGTGTCCGTTATGAGTGCCAAACTCGAGTTTGGCACTCATAACGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002923
VALIDATED
RGS2 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 2, 24kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-508s1c1
Sequence:CCGGCCCAGAATATACAAGAAGCTACTCGAGTAGCTTCTTGTATATTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-158s1c1
Sequence:CCGGGACCCGTTTGAGCTACTTCTTCTCGAGAAGAAGTAGCTCAAACGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-510s1c1
Sequence:CCGGCAGAATATACAAGAAGCTACACTCGAGTGTAGCTTCTTGTATATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002923.2-159s21c1
Sequence:CCGGCCCGTTTGAGCTACTTCTTACCTCGAGGTAAGAAGTAGCTCAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-569s21c1
Sequence:CCGGTTGATGGAGAACAACTCTTATCTCGAGATAAGAGTTGTTCTCCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-611s21c1
Sequence:CCGGTTCTACCAGGACTTGTGTAAACTCGAGTTTACACAAGTCCTGGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-650s21c1
Sequence:CCGGGAGCCTCATGCTACATGAAATCTCGAGATTTCATGTAGCATGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002923.2-1247s21c1
Sequence:CCGGGTGTCCGTTATGAGTGCCAAACTCGAGTTTGGCACTCATAACGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002923
VALIDATED
RGS2 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 2, 24kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-508s1c1
Sequence:CCGGCCCAGAATATACAAGAAGCTACTCGAGTAGCTTCTTGTATATTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-158s1c1
Sequence:CCGGGACCCGTTTGAGCTACTTCTTCTCGAGAAGAAGTAGCTCAAACGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002923.x-510s1c1
Sequence:CCGGCAGAATATACAAGAAGCTACACTCGAGTGTAGCTTCTTGTATATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002923.2-159s21c1
Sequence:CCGGCCCGTTTGAGCTACTTCTTACCTCGAGGTAAGAAGTAGCTCAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-569s21c1
Sequence:CCGGTTGATGGAGAACAACTCTTATCTCGAGATAAGAGTTGTTCTCCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-611s21c1
Sequence:CCGGTTCTACCAGGACTTGTGTAAACTCGAGTTTACACAAGTCCTGGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002923.2-650s21c1
Sequence:CCGGGAGCCTCATGCTACATGAAATCTCGAGATTTCATGTAGCATGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002923.2-1247s21c1
Sequence:CCGGGTGTCCGTTATGAGTGCCAAACTCGAGTTTGGCACTCATAACGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)