EMAIL THIS PAGE TO A FRIEND

RGS4

regulator of G-protein signaling 4

192 Gene Product Result for
Synonyms: RGP4 SCZD9
UniProtKB ID: P49798, A7XA56, A7XA58, A7XA59, A7YVV7, B1APZ3
Gene ID:
Human(5999) Summary: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19736) regulator of G-protein signaling 4
Rat(29480) regulator of G-protein signaling 4
Zebrafish(569876) regulator of G-protein signalling 4
dog(488666) regulator of G-protein signaling 4
domestic cat(101083058) regulator of G-protein signaling 4
chicken(378901) regulator of G-protein signaling 4
Domestic Rabbit(100009014) regulator of G-protein signaling 4
naked mole-rat(101713440) regulator of G-protein signaling 4
domestic guinea pig(100717645) regulator of G-protein signaling 4
cow(617437) regulator of G-protein signaling 4
sheep(100381246) regulator of G-protein signaling 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005613 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023381 MISSION® esiRNA esiRNA targeting mouse Rgs4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102445 Rosetta Predictions human pricing
NM_001113380 Rosetta Predictions human pricing
NM_001113381 Rosetta Predictions human pricing
NM_005613 Rosetta Predictions human pricing
NM_017214 Rosetta Predictions rat pricing
NM_009062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323153 predicted 1249
2 SASI_Hs02_00323154 predicted 1384
3 SASI_Hs02_00323155 predicted 589
4 SASI_Hs02_00323156 predicted 1323
5 SASI_Hs02_00323157 predicted 1035
6 SASI_Hs02_00323158 predicted 1306
7 SASI_Hs02_00323159 predicted 1029
8 SASI_Hs02_00323160 predicted 1132
9 SASI_Hs02_00323161 predicted 783
10 SASI_Hs02_00323162 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325761 predicted 829
2 SASI_Hs02_00325762 predicted 953
3 SASI_Hs02_00325763 predicted 872
4 SASI_Hs02_00325764 predicted 897
5 SASI_Hs02_00325765 predicted 609
6 SASI_Hs02_00325766 predicted 886
7 SASI_Hs02_00325767 predicted 603
8 SASI_Hs02_00325768 predicted 706
9 SASI_Hs02_00325769 predicted 359
10 SASI_Hs02_00325770 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325771 predicted 696
2 SASI_Hs02_00325772 predicted 820
3 SASI_Hs02_00325773 predicted 735
4 SASI_Hs02_00325774 predicted 768
5 SASI_Hs02_00325775 predicted 479
6 SASI_Hs02_00325776 predicted 748
7 SASI_Hs02_00325777 predicted 474
8 SASI_Hs02_00325778 predicted 576
9 SASI_Hs02_00325779 predicted 393
10 SASI_Hs02_00325780 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193226 predicted 1144
2 SASI_Hs02_00339934 predicted 1269
3 SASI_Hs01_00193219 predicted 1181
4 SASI_Hs01_00193218 predicted 1215
5 SASI_Hs01_00193220 predicted 928
6 SASI_Hs01_00193221 predicted 1200
7 SASI_Hs01_00193222 predicted 919
8 SASI_Hs01_00193224 predicted 1021
9 SASI_Hs01_00193225 predicted 675
10 SASI_Hs01_00193227 predicted 812
11 SASI_Hs01_00193223 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068141 predicted 777
2 SASI_Rn01_00068142 predicted 303
3 SASI_Rn01_00068143 predicted 523
4 SASI_Rn01_00068144 predicted 783
5 SASI_Rn01_00068145 predicted 220
6 SASI_Rn02_00261577 predicted 505
7 SASI_Rn01_00068146 predicted 410
8 SASI_Rn01_00068147 predicted 781
9 SASI_Rn01_00068148 predicted 201
10 SASI_Rn01_00068149 predicted 602
11 SASI_Rn01_00068150 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067426 predicted 321
2 SASI_Mm01_00067428 predicted 231
3 SASI_Mm01_00067429 predicted 530
4 SASI_Mm01_00067430 predicted 517
5 SASI_Mm01_00067431 predicted 806
6 SASI_Mm01_00067432 predicted 424
7 SASI_Mm01_00067433 predicted 415
8 SASI_Mm01_00067435 predicted 420
9 SASI_Mm02_00315233 predicted 204
10 SASI_Mm02_00315234 predicted 215
11 SASI_Mm01_00067427 predicted 322
12 SASI_Mm01_00067434 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009062
RGS4 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-260s1c1
Sequence:CCGGGAAGTCAAGAAATGGGCTGAACTCGAGTTCAGCCCATTTCTTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-136s1c1
Sequence:CCGGGAGGAGTGCAAAGGACATGAACTCGAGTTCATGTCCTTTGCACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-657s1c1
Sequence:CCGGAGCAGAAAGGAGCCAAGAGTTCTCGAGAACTCTTGGCTCCTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-523s1c1
Sequence:CCGGACAGCCCACAATAACCTGTTTCTCGAGAAACAGGTTATTGTGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-407s1c1
Sequence:CCGGCCTTCTAAACTAAGTCCCAAACTCGAGTTTGGGACTTAGTTTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009062
RGS4 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-260s1c1
Sequence:CCGGGAAGTCAAGAAATGGGCTGAACTCGAGTTCAGCCCATTTCTTGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-136s1c1
Sequence:CCGGGAGGAGTGCAAAGGACATGAACTCGAGTTCATGTCCTTTGCACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-657s1c1
Sequence:CCGGAGCAGAAAGGAGCCAAGAGTTCTCGAGAACTCTTGGCTCCTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-523s1c1
Sequence:CCGGACAGCCCACAATAACCTGTTTCTCGAGAAACAGGTTATTGTGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-407s1c1
Sequence:CCGGCCTTCTAAACTAAGTCCCAAACTCGAGTTTGGGACTTAGTTTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009062
RGS4 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-260s1c1
Sequence:CCGGGAAGTCAAGAAATGGGCTGAACTCGAGTTCAGCCCATTTCTTGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-136s1c1
Sequence:CCGGGAGGAGTGCAAAGGACATGAACTCGAGTTCATGTCCTTTGCACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-657s1c1
Sequence:CCGGAGCAGAAAGGAGCCAAGAGTTCTCGAGAACTCTTGGCTCCTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-523s1c1
Sequence:CCGGACAGCCCACAATAACCTGTTTCTCGAGAAACAGGTTATTGTGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009062.2-407s1c1
Sequence:CCGGCCTTCTAAACTAAGTCCCAAACTCGAGTTTGGGACTTAGTTTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005613
RGS4 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005613.3-2444s1c1
Sequence:CCGGGCCAATATAATGGGCTGCAAACTCGAGTTTGCAGCCCATTATATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-278s1c1
Sequence:CCGGAGCCAAGAGGAAGTCAAGAAACTCGAGTTTCTTGACTTCCTCTTGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-433s1c1
Sequence:CCGGACCATCTAAACTAAGTCCCAACTCGAGTTGGGACTTAGTTTAGATGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-625s1c1
Sequence:CCGGCTTCCTCAAGTCTCGATTCTACTCGAGTAGAATCGAGACTTGAGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005613.5-624s21c1
Sequence:CCGGCCCACAACAAGAAGGACAAAGCTCGAGCTTTGTCCTTCTTGTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-551s1c1
Sequence:CCGGGAGCCTACAATAACCTGCTTTCTCGAGAAAGCAGGTTATTGTAGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1223s21c1
Sequence:CCGGATCCACATTGTAGCCTAATATCTCGAGATATTAGGCTACAATGTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1263s21c1
Sequence:CCGGTGAGTCACTTCTACGCATAAACTCGAGTTTATGCGTAGAAGTGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005613
RGS4 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005613.3-2444s1c1
Sequence:CCGGGCCAATATAATGGGCTGCAAACTCGAGTTTGCAGCCCATTATATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-278s1c1
Sequence:CCGGAGCCAAGAGGAAGTCAAGAAACTCGAGTTTCTTGACTTCCTCTTGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-433s1c1
Sequence:CCGGACCATCTAAACTAAGTCCCAACTCGAGTTGGGACTTAGTTTAGATGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-625s1c1
Sequence:CCGGCTTCCTCAAGTCTCGATTCTACTCGAGTAGAATCGAGACTTGAGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005613.5-624s21c1
Sequence:CCGGCCCACAACAAGAAGGACAAAGCTCGAGCTTTGTCCTTCTTGTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-551s1c1
Sequence:CCGGGAGCCTACAATAACCTGCTTTCTCGAGAAAGCAGGTTATTGTAGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1223s21c1
Sequence:CCGGATCCACATTGTAGCCTAATATCTCGAGATATTAGGCTACAATGTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1263s21c1
Sequence:CCGGTGAGTCACTTCTACGCATAAACTCGAGTTTATGCGTAGAAGTGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005613
RGS4 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005613.3-2444s1c1
Sequence:CCGGGCCAATATAATGGGCTGCAAACTCGAGTTTGCAGCCCATTATATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-278s1c1
Sequence:CCGGAGCCAAGAGGAAGTCAAGAAACTCGAGTTTCTTGACTTCCTCTTGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-433s1c1
Sequence:CCGGACCATCTAAACTAAGTCCCAACTCGAGTTGGGACTTAGTTTAGATGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-625s1c1
Sequence:CCGGCTTCCTCAAGTCTCGATTCTACTCGAGTAGAATCGAGACTTGAGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005613.5-624s21c1
Sequence:CCGGCCCACAACAAGAAGGACAAAGCTCGAGCTTTGTCCTTCTTGTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005613.3-551s1c1
Sequence:CCGGGAGCCTACAATAACCTGCTTTCTCGAGAAAGCAGGTTATTGTAGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1223s21c1
Sequence:CCGGATCCACATTGTAGCCTAATATCTCGAGATATTAGGCTACAATGTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005613.5-1263s21c1
Sequence:CCGGTGAGTCACTTCTACGCATAAACTCGAGTTTATGCGTAGAAGTGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)