EMAIL THIS PAGE TO A FRIEND

RGS5

regulator of G-protein signaling 5

102 Gene Product Result for
Synonyms: MST092 MST106 MST129 MSTP032 MSTP092 MSTP106 MSTP129
UniProtKB ID: O15539, E9PMP5, Q53XA9, Q599J0
Gene ID:
Human(8490) Summary: This gene encodes a member of the regulators of G protein signaling (RGS) family. The RGS proteins are signal transduction molecules which are involved in the regulation of heterotrimeric G proteins by acting as GTPase activators. This gene is a hypoxia-inducible factor-1 dependent, hypoxia-induced gene which is involved in the induction of endothelial apoptosis. This gene is also one of three genes on chromosome 1q contributing to elevated blood pressure. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Dec 2011]
Mouse(19737) regulator of G-protein signaling 5
Rat(54294) regulator of G-protein signaling 5
cow(540509) regulator of G-protein signaling 5
sheep(101110554) regulator of G-protein signaling 5
domestic guinea pig(100730351) regulator of G-protein signaling 5
naked mole-rat(101712474) regulator of G-protein signaling 5
chicken(769998) regulator of G-protein signaling 5
dog(488667) regulator of G-protein signaling 5
domestic cat(101082542) regulator of G-protein signaling 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003617 Rosetta Predictions human pricing
NM_019341 Rosetta Predictions rat pricing
NM_009063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094781 predicted 431
2 SASI_Hs01_00094782 predicted 736
3 SASI_Hs01_00094783 predicted 355
4 SASI_Hs01_00094784 predicted 617
5 SASI_Hs01_00094785 predicted 433
6 SASI_Hs01_00094786 predicted 886
7 SASI_Hs01_00094787 predicted 769
8 SASI_Hs01_00094788 predicted 627
9 SASI_Hs01_00094789 predicted 696
10 SASI_Hs02_00335959 predicted 746
11 SASI_Hs01_00094790 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098098 predicted 208
2 SASI_Rn01_00098099 predicted 275
3 SASI_Rn01_00098100 predicted 275
4 SASI_Rn01_00098101 predicted 214
5 SASI_Rn01_00098102 predicted 247
6 SASI_Rn01_00098103 predicted 274
7 SASI_Rn01_00098104 predicted 214
8 SASI_Rn01_00098105 predicted 207
9 SASI_Rn02_00262332 predicted 320
10 SASI_Rn01_00098106 predicted 318
11 SASI_Rn01_00098107 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127762 predicted 317
2 SASI_Mm01_00127763 predicted 577
3 SASI_Mm02_00315235 predicted 583
4 SASI_Mm01_00127764 predicted 542
5 SASI_Mm01_00127765 predicted 405
6 SASI_Mm01_00127766 predicted 1069
7 SASI_Mm01_00127767 predicted 457
8 SASI_Mm01_00127768 predicted 1093
9 SASI_Mm01_00127769 predicted 491
10 SASI_Mm01_00127770 predicted 504
11 SASI_Mm01_00127771 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009063
RGS5 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-408s21c1
Sequence:CCGGGAGAAGGCAAAGCAAATTTATCTCGAGATAAATTTGCTTTGCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-609s21c1
Sequence:CCGGGAGCTAATCAAGTAGTCATCTCTCGAGAGATGACTACTTGATTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009063.3-1023s21c1
Sequence:CCGGGGATTTGACTGGTCTTGTTTACTCGAGTAAACAAGACCAGTCAAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009063.2-1180s1c1
Sequence:CCGGCCGCTGTGTTATCTGGACATTCTCGAGAATGTCCAGATAACACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-181s1c1
Sequence:CCGGGACCTTGTCATTCCATACAATCTCGAGATTGTATGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-581s1c1
Sequence:CCGGCCCGCTTTGTGCGCTCTGAATCTCGAGATTCAGAGCGCACAAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-471s1c1
Sequence:CCGGTGACCACTTCACTAAAGACATCTCGAGATGTCTTTAGTGAAGTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-365s1c1
Sequence:CCGGCCTGTGAGAATTACAAGAAGACTCGAGTCTTCTTGTAATTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009063
RGS5 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-408s21c1
Sequence:CCGGGAGAAGGCAAAGCAAATTTATCTCGAGATAAATTTGCTTTGCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-609s21c1
Sequence:CCGGGAGCTAATCAAGTAGTCATCTCTCGAGAGATGACTACTTGATTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009063.3-1023s21c1
Sequence:CCGGGGATTTGACTGGTCTTGTTTACTCGAGTAAACAAGACCAGTCAAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009063.2-1180s1c1
Sequence:CCGGCCGCTGTGTTATCTGGACATTCTCGAGAATGTCCAGATAACACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-181s1c1
Sequence:CCGGGACCTTGTCATTCCATACAATCTCGAGATTGTATGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-581s1c1
Sequence:CCGGCCCGCTTTGTGCGCTCTGAATCTCGAGATTCAGAGCGCACAAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-471s1c1
Sequence:CCGGTGACCACTTCACTAAAGACATCTCGAGATGTCTTTAGTGAAGTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-365s1c1
Sequence:CCGGCCTGTGAGAATTACAAGAAGACTCGAGTCTTCTTGTAATTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009063
RGS5 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-408s21c1
Sequence:CCGGGAGAAGGCAAAGCAAATTTATCTCGAGATAAATTTGCTTTGCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009063.3-609s21c1
Sequence:CCGGGAGCTAATCAAGTAGTCATCTCTCGAGAGATGACTACTTGATTAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009063.3-1023s21c1
Sequence:CCGGGGATTTGACTGGTCTTGTTTACTCGAGTAAACAAGACCAGTCAAATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009063.2-1180s1c1
Sequence:CCGGCCGCTGTGTTATCTGGACATTCTCGAGAATGTCCAGATAACACAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-181s1c1
Sequence:CCGGGACCTTGTCATTCCATACAATCTCGAGATTGTATGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-581s1c1
Sequence:CCGGCCCGCTTTGTGCGCTCTGAATCTCGAGATTCAGAGCGCACAAAGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-471s1c1
Sequence:CCGGTGACCACTTCACTAAAGACATCTCGAGATGTCTTTAGTGAAGTGGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009063.2-365s1c1
Sequence:CCGGCCTGTGAGAATTACAAGAAGACTCGAGTCTTCTTGTAATTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003617
VALIDATED
RGS5 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003617.2-833s21c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-350s21c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-459s21c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-833s1c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-620s1c1
Sequence:CCGGGCTCCTAAAGAGGTGAATATTCTCGAGAATATTCACCTCTTTAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-459s1c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-350s1c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-295s1c1
Sequence:CCGGCAAGGAGATTAAGATCAAGTTCTCGAGAACTTGATCTTAATCTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003617
VALIDATED
RGS5 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003617.2-833s21c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-350s21c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-459s21c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-833s1c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-620s1c1
Sequence:CCGGGCTCCTAAAGAGGTGAATATTCTCGAGAATATTCACCTCTTTAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-459s1c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-350s1c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-295s1c1
Sequence:CCGGCAAGGAGATTAAGATCAAGTTCTCGAGAACTTGATCTTAATCTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003617
VALIDATED
RGS5 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003617.2-833s21c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-350s21c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003617.2-459s21c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-833s1c1
Sequence:CCGGCCTCCATAATAACCCTGCATTCTCGAGAATGCAGGGTTATTATGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-620s1c1
Sequence:CCGGGCTCCTAAAGAGGTGAATATTCTCGAGAATATTCACCTCTTTAGGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-459s1c1
Sequence:CCGGACAACTATGGACTTGCCAGTTCTCGAGAACTGGCAAGTCCATAGTTGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003617.2-350s1c1
Sequence:CCGGGACCTTGTCATTCCGTACAATCTCGAGATTGTACGGAATGACAAGGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003617.2-295s1c1
Sequence:CCGGCAAGGAGATTAAGATCAAGTTCTCGAGAACTTGATCTTAATCTCCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)