EMAIL THIS PAGE TO A FRIEND

RGS7

regulator of G-protein signaling 7

90 Gene Product Result for
Gene ID:
Mouse(24012) regulator of G protein signaling 7
Rat(54296) regulator of G-protein signaling 7
cow(281452) regulator of G-protein signaling 7
sheep(101121279) regulator of G-protein signaling 7
domestic guinea pig(100732500) regulator of G-protein signaling 7
naked mole-rat(101713842) regulator of G-protein signaling 7
Zebrafish(436814) regulator of G-protein signalling 7
domestic cat(101096781) regulator of G-protein signaling 7
Horse(100054733) regulator of G-protein signaling 7
dog(100687600) regulator of G-protein signaling 7
chicken(395620) regulator of G-protein signaling 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002924 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090381 MISSION® esiRNA esiRNA human RGS7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002924 Rosetta Predictions human pricing
NM_019343 Rosetta Predictions rat pricing
NM_011880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104392 predicted 1010
2 SASI_Hs01_00104393 predicted 1090
3 SASI_Hs01_00104394 predicted 1354
4 SASI_Hs01_00104395 predicted 1623
5 SASI_Hs01_00104396 predicted 1467
6 SASI_Hs01_00104397 predicted 886
7 SASI_Hs01_00104398 predicted 505
8 SASI_Hs01_00104399 predicted 1095
9 SASI_Hs01_00104400 predicted 1520
10 SASI_Hs01_00104401 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107785 predicted 999
2 SASI_Rn01_00107787 predicted 1244
3 SASI_Rn02_00262333 predicted 1404
4 SASI_Rn01_00107788 predicted 328
5 SASI_Rn01_00107789 predicted 1125
6 SASI_Rn01_00107790 predicted 1029
7 SASI_Rn01_00107791 predicted 411
8 SASI_Rn01_00107792 predicted 1528
9 SASI_Rn02_00262334 predicted 717
10 SASI_Rn01_00107793 predicted 1078
11 SASI_Rn01_00107786 predicted 1104
12 SASI_Rn01_00107794 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114451 predicted 1363
2 SASI_Mm01_00114452 predicted 1785
3 SASI_Mm01_00114459 predicted 1816
4 SASI_Mm01_00114455 predicted 1524
5 SASI_Mm02_00321672 predicted 1704
6 SASI_Mm01_00114457 predicted 886
7 SASI_Mm01_00114458 predicted 1322
8 SASI_Mm01_00114460 predicted 1178
9 SASI_Mm02_00321673 predicted 1594
10 SASI_Mm02_00321674 predicted 1823
11 SASI_Mm01_00114453 predicted 1239
12 SASI_Mm01_00114454 predicted 1136
13 SASI_Mm01_00114456 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011880
RGS7 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1357s1c1
Sequence:CCGGCCAGTGCCATTAACTTGGATTCTCGAGAATCCAAGTTAATGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-831s1c1
Sequence:CCGGCGGATGAGAAACCCACACAAACTCGAGTTTGTGTGGGTTTCTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1014s1c1
Sequence:CCGGGCTGATAGTCTACTAAGCTATCTCGAGATAGCTTAGTAGACTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1416s1c1
Sequence:CCGGCCAGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-270s1c1
Sequence:CCGGGCACGTATGCAAGACGAGAAACTCGAGTTTCTCGTCTTGCATACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011880
RGS7 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1357s1c1
Sequence:CCGGCCAGTGCCATTAACTTGGATTCTCGAGAATCCAAGTTAATGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-831s1c1
Sequence:CCGGCGGATGAGAAACCCACACAAACTCGAGTTTGTGTGGGTTTCTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1014s1c1
Sequence:CCGGGCTGATAGTCTACTAAGCTATCTCGAGATAGCTTAGTAGACTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1416s1c1
Sequence:CCGGCCAGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-270s1c1
Sequence:CCGGGCACGTATGCAAGACGAGAAACTCGAGTTTCTCGTCTTGCATACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011880
RGS7 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1357s1c1
Sequence:CCGGCCAGTGCCATTAACTTGGATTCTCGAGAATCCAAGTTAATGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-831s1c1
Sequence:CCGGCGGATGAGAAACCCACACAAACTCGAGTTTGTGTGGGTTTCTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1014s1c1
Sequence:CCGGGCTGATAGTCTACTAAGCTATCTCGAGATAGCTTAGTAGACTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-1416s1c1
Sequence:CCGGCCAGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011880.1-270s1c1
Sequence:CCGGGCACGTATGCAAGACGAGAAACTCGAGTTTCTCGTCTTGCATACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002924
RGS7 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002924.2-1839s1c1
Sequence:CCGGGCACACACTTTGTAGCTCAATCTCGAGATTGAGCTACAAAGTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1515s1c1
Sequence:CCGGCCCAGTGCTATTAACTTGGATCTCGAGATCCAAGTTAATAGCACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1014s1c1
Sequence:CCGGCGGAAGTCTGTCTATGGTTTACTCGAGTAAACCATAGACAGACTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1089s1c1
Sequence:CCGGCCTCCAACAGAAGATGAGTTACTCGAGTAACTCATCTTCTGTTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1575s1c1
Sequence:CCGGCCTGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-1893s21c1
Sequence:CCGGGCATGAGCAAAGGACCTAAATCTCGAGATTTAGGTCCTTTGCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-2218s21c1
Sequence:CCGGTCCGCACAGAAAGTTTCATTTCTCGAGAAATGAAACTTTCTGTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002924
RGS7 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002924.2-1839s1c1
Sequence:CCGGGCACACACTTTGTAGCTCAATCTCGAGATTGAGCTACAAAGTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1515s1c1
Sequence:CCGGCCCAGTGCTATTAACTTGGATCTCGAGATCCAAGTTAATAGCACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1014s1c1
Sequence:CCGGCGGAAGTCTGTCTATGGTTTACTCGAGTAAACCATAGACAGACTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1089s1c1
Sequence:CCGGCCTCCAACAGAAGATGAGTTACTCGAGTAACTCATCTTCTGTTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1575s1c1
Sequence:CCGGCCTGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-1893s21c1
Sequence:CCGGGCATGAGCAAAGGACCTAAATCTCGAGATTTAGGTCCTTTGCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-2218s21c1
Sequence:CCGGTCCGCACAGAAAGTTTCATTTCTCGAGAAATGAAACTTTCTGTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002924
RGS7 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002924.2-1839s1c1
Sequence:CCGGGCACACACTTTGTAGCTCAATCTCGAGATTGAGCTACAAAGTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1515s1c1
Sequence:CCGGCCCAGTGCTATTAACTTGGATCTCGAGATCCAAGTTAATAGCACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1014s1c1
Sequence:CCGGCGGAAGTCTGTCTATGGTTTACTCGAGTAAACCATAGACAGACTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1089s1c1
Sequence:CCGGCCTCCAACAGAAGATGAGTTACTCGAGTAACTCATCTTCTGTTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002924.2-1575s1c1
Sequence:CCGGCCTGGACGATACACATTTGAACTCGAGTTCAAATGTGTATCGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-1893s21c1
Sequence:CCGGGCATGAGCAAAGGACCTAAATCTCGAGATTTAGGTCCTTTGCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002924.4-2218s21c1
Sequence:CCGGTCCGCACAGAAAGTTTCATTTCTCGAGAAATGAAACTTTCTGTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)