EMAIL THIS PAGE TO A FRIEND

RGS8

regulator of G-protein signaling 8

68 Gene Product Result for
UniProtKB ID: P57771, B4DGL9, Q3SYD2
Gene ID:
Human(85397) Summary: This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
Mouse(67792) regulator of G-protein signaling 8
Rat(54297) regulator of G-protein signaling 8
Zebrafish(436804) regulator of G-protein signaling 8
domestic cat(101091750) regulator of G-protein signaling 8
dog(490311) regulator of G-protein signaling 8
chicken(426557) regulator of G-protein signaling 8
cow(781543) regulator of G-protein signaling 8
sheep(101103997) regulator of G-protein signaling 8
domestic guinea pig(100730487) regulator of G-protein signaling 8
naked mole-rat(101722504) regulator of G-protein signaling 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102450 Rosetta Predictions human pricing
NM_033345 Rosetta Predictions human pricing
NM_019344 Rosetta Predictions rat pricing
NM_026380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323163 predicted 634
2 SASI_Hs02_00323164 predicted 629
3 SASI_Hs02_00323165 predicted 640
4 SASI_Hs02_00323166 predicted 587
5 SASI_Hs02_00323167 predicted 654
6 SASI_Hs02_00323168 predicted 604
7 SASI_Hs02_00323169 predicted 662
8 SASI_Hs02_00323170 predicted 593
9 SASI_Hs02_00323171 predicted 634
10 SASI_Hs02_00323172 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361194 predicted 506
2 SASI_Hs02_00361195 predicted 507
3 SASI_Hs02_00361196 predicted 512
4 SASI_Hs01_00036913 predicted 460
5 SASI_Hs01_00036914 predicted 521
6 SASI_Hs02_00361197 predicted 468
7 SASI_Hs02_00361198 predicted 541
8 SASI_Hs02_00361199 predicted 457
9 SASI_Hs02_00361200 predicted 504
10 SASI_Hs02_00361201 predicted 515
11 SASI_Hs01_00036906 predicted 311
12 SASI_Hs01_00036907 predicted 257
13 SASI_Hs01_00036908 predicted 324
14 SASI_Hs01_00036909 predicted 480
15 SASI_Hs01_00036910 predicted 286
16 SASI_Hs01_00036911 predicted 377
17 SASI_Hs01_00036912 predicted 363
18 SASI_Hs01_00036915 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045591 predicted 1383
2 SASI_Rn01_00045592 predicted 866
3 SASI_Rn01_00045593 predicted 1442
4 SASI_Rn01_00045595 predicted 1200
5 SASI_Rn01_00045596 predicted 1322
6 SASI_Rn01_00045597 predicted 1198
7 SASI_Rn01_00045598 predicted 904
8 SASI_Rn01_00045600 predicted 875
9 SASI_Rn02_00262335 predicted 1382
10 SASI_Rn02_00262336 predicted 1227
11 SASI_Rn01_00045594 predicted 1200
12 SASI_Rn01_00045599 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035855 predicted 1297
2 SASI_Mm01_00035856 predicted 1098
3 SASI_Mm01_00035857 predicted 1457
4 SASI_Mm01_00035858 predicted 1424
5 SASI_Mm01_00035859 predicted 1539
6 SASI_Mm01_00035861 predicted 975
7 SASI_Mm01_00035862 predicted 1300
8 SASI_Mm01_00035863 predicted 1294
9 SASI_Mm01_00035864 predicted 1292
10 SASI_Mm02_00330125 predicted 1361
11 SASI_Mm01_00035860 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026380
RGS8 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026380.3-1102s21c1
Sequence:CCGGACCATATTCTGAAGTGAAATGCTCGAGCATTTCACTTCAGAATATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-631s21c1
Sequence:CCGGAGAGACTCTCCACGGAAGAAGCTCGAGCTTCTTCCGTGGAGAGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026380.3-2196s1c1
Sequence:CCGGCCTGGGAAGATCACTGTGAATCTCGAGATTCACAGTGATCTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-782s1c1
Sequence:CCGGGAAGACCAGGTCAACTGCAAACTCGAGTTTGCAGTTGACCTGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-891s1c1
Sequence:CCGGGCCACGAGGAAGAACATGCAACTCGAGTTGCATGTTCTTCCTCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-718s21c1
Sequence:CCGGCCTTCTTGAAGACGGAGTTCACTCGAGTGAACTCCGTCTTCAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-981s21c1
Sequence:CCGGCCTAGGTTCCTGAGGTCCAAACTCGAGTTTGGACCTCAGGAACCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026380
RGS8 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026380.3-1102s21c1
Sequence:CCGGACCATATTCTGAAGTGAAATGCTCGAGCATTTCACTTCAGAATATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-631s21c1
Sequence:CCGGAGAGACTCTCCACGGAAGAAGCTCGAGCTTCTTCCGTGGAGAGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026380.3-2196s1c1
Sequence:CCGGCCTGGGAAGATCACTGTGAATCTCGAGATTCACAGTGATCTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-782s1c1
Sequence:CCGGGAAGACCAGGTCAACTGCAAACTCGAGTTTGCAGTTGACCTGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-891s1c1
Sequence:CCGGGCCACGAGGAAGAACATGCAACTCGAGTTGCATGTTCTTCCTCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-718s21c1
Sequence:CCGGCCTTCTTGAAGACGGAGTTCACTCGAGTGAACTCCGTCTTCAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-981s21c1
Sequence:CCGGCCTAGGTTCCTGAGGTCCAAACTCGAGTTTGGACCTCAGGAACCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026380
RGS8 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026380.3-1102s21c1
Sequence:CCGGACCATATTCTGAAGTGAAATGCTCGAGCATTTCACTTCAGAATATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-631s21c1
Sequence:CCGGAGAGACTCTCCACGGAAGAAGCTCGAGCTTCTTCCGTGGAGAGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026380.3-2196s1c1
Sequence:CCGGCCTGGGAAGATCACTGTGAATCTCGAGATTCACAGTGATCTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-782s1c1
Sequence:CCGGGAAGACCAGGTCAACTGCAAACTCGAGTTTGCAGTTGACCTGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026380.3-891s1c1
Sequence:CCGGGCCACGAGGAAGAACATGCAACTCGAGTTGCATGTTCTTCCTCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-718s21c1
Sequence:CCGGCCTTCTTGAAGACGGAGTTCACTCGAGTGAACTCCGTCTTCAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026380.3-981s21c1
Sequence:CCGGCCTAGGTTCCTGAGGTCCAAACTCGAGTTTGGACCTCAGGAACCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033345
RGS8 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-268s1c1
Sequence:CCGGCTCAAGAGATTATCGACAGAACTCGAGTTCTGTCGATAATCTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-221s1c1
Sequence:CCGGCGTGTAGTGATTTCACAGCTACTCGAGTAGCTGTGAAATCACTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-162s1c1
Sequence:CCGGCCAAAGACAGAACAAAGGGATCTCGAGATCCCTTTGTTCTGTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-375s21c1
Sequence:CCGGTGCCTTCTTGAAGACGGAGTTCTCGAGAACTCCGTCTTCAAGAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-459s1c1
Sequence:CCGGCCATAGGATCTTTGAGGAGTTCTCGAGAACTCCTCAAAGATCCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-565s1c1
Sequence:CCGGACTTGCTTTGACCAAGCCCAACTCGAGTTGGGCTTGGTCAAAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-137s21c1
Sequence:CCGGCTGACCATCCAGTTGGCAAAGCTCGAGCTTTGCCAACTGGATGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033345
RGS8 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-268s1c1
Sequence:CCGGCTCAAGAGATTATCGACAGAACTCGAGTTCTGTCGATAATCTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-221s1c1
Sequence:CCGGCGTGTAGTGATTTCACAGCTACTCGAGTAGCTGTGAAATCACTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-162s1c1
Sequence:CCGGCCAAAGACAGAACAAAGGGATCTCGAGATCCCTTTGTTCTGTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-375s21c1
Sequence:CCGGTGCCTTCTTGAAGACGGAGTTCTCGAGAACTCCGTCTTCAAGAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-459s1c1
Sequence:CCGGCCATAGGATCTTTGAGGAGTTCTCGAGAACTCCTCAAAGATCCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-565s1c1
Sequence:CCGGACTTGCTTTGACCAAGCCCAACTCGAGTTGGGCTTGGTCAAAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-137s21c1
Sequence:CCGGCTGACCATCCAGTTGGCAAAGCTCGAGCTTTGCCAACTGGATGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033345
RGS8 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-268s1c1
Sequence:CCGGCTCAAGAGATTATCGACAGAACTCGAGTTCTGTCGATAATCTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-221s1c1
Sequence:CCGGCGTGTAGTGATTTCACAGCTACTCGAGTAGCTGTGAAATCACTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-162s1c1
Sequence:CCGGCCAAAGACAGAACAAAGGGATCTCGAGATCCCTTTGTTCTGTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-375s21c1
Sequence:CCGGTGCCTTCTTGAAGACGGAGTTCTCGAGAACTCCGTCTTCAAGAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-459s1c1
Sequence:CCGGCCATAGGATCTTTGAGGAGTTCTCGAGAACTCCTCAAAGATCCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033345.1-565s1c1
Sequence:CCGGACTTGCTTTGACCAAGCCCAACTCGAGTTGGGCTTGGTCAAAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033345.2-137s21c1
Sequence:CCGGCTGACCATCCAGTTGGCAAAGCTCGAGCTTTGCCAACTGGATGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)