EMAIL THIS PAGE TO A FRIEND

RGS9

regulator of G-protein signaling 9

65 Gene Product Result for
Synonyms: PERRS RGS9L
Gene ID:
Human(8787) Summary: This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(19739) regulator of G-protein signaling 9
Rat(29481) regulator of G-protein signaling 9
naked mole-rat(101718218) regulator of G-protein signaling 9
domestic guinea pig(100731440) regulator of G-protein signaling 9
cow(281453) regulator of G-protein signaling 9
sheep(101109549) regulator of G-protein signaling 9
chicken(417433) regulator of G-protein signaling 9
Horse(100053338) regulator of G-protein signaling 9
dog(490902) regulator of G-protein signaling 9
domestic cat(101087024) regulator of G-protein signaling 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003835 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081955 Rosetta Predictions human pricing
NM_003835 Rosetta Predictions human pricing
NM_019224 Rosetta Predictions rat pricing
NM_011268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316593 predicted 2179
2 SASI_Hs02_00316594 predicted 317
3 SASI_Hs02_00316595 predicted 1111
4 SASI_Hs02_00316596 predicted 310
5 SASI_Hs02_00316597 predicted 1302
6 SASI_Hs02_00316598 predicted 1191
7 SASI_Hs02_00316599 predicted 1327
8 SASI_Hs02_00316600 predicted 458
9 SASI_Hs02_00316601 predicted 971
10 SASI_Hs02_00316602 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111159 predicted 2182
2 SASI_Hs02_00336395 predicted 317
3 SASI_Hs01_00111162 predicted 1122
4 SASI_Hs02_00336396 predicted 310
5 SASI_Hs01_00111163 predicted 1310
6 SASI_Hs01_00111164 predicted 1197
7 SASI_Hs02_00336397 predicted 1332
8 SASI_Hs02_00336398 predicted 465
9 SASI_Hs01_00111167 predicted 975
10 SASI_Hs02_00336399 predicted 412
11 SASI_Hs01_00111158 predicted 1131
12 SASI_Hs01_00111160 predicted 1159
13 SASI_Hs01_00111161 predicted 947
14 SASI_Hs01_00111165 predicted 1985
15 SASI_Hs01_00111166 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074086 predicted 1005
2 SASI_Rn01_00074087 predicted 1199
3 SASI_Rn01_00074089 predicted 362
4 SASI_Rn01_00074090 predicted 490
5 SASI_Rn02_00262082 predicted 999
6 SASI_Rn01_00074091 predicted 798
7 SASI_Rn01_00074092 predicted 1988
8 SASI_Rn01_00074093 predicted 631
9 SASI_Rn01_00074094 predicted 1356
10 SASI_Rn01_00074095 predicted 484
11 SASI_Rn01_00074088 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320290 predicted 1154
2 SASI_Mm01_00126878 predicted 1075
3 SASI_Mm01_00126879 predicted 692
4 SASI_Mm01_00126880 predicted 1372
5 SASI_Mm02_00320291 predicted 491
6 SASI_Mm01_00126881 predicted 765
7 SASI_Mm01_00126883 predicted 829
8 SASI_Mm01_00126884 predicted 864
9 SASI_Mm01_00126885 predicted 1269
10 SASI_Mm01_00126886 predicted 1373
11 SASI_Mm01_00126877 predicted 361
12 SASI_Mm01_00126882 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003835
RGS9 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-572s21c1
Sequence:CCGGCTATCTGGCCAAGCGAAATATCTCGAGATATTTCGCTTGGCCAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-506s21c1
Sequence:CCGGCAGATTTCAGACACCGTATTTCTCGAGAAATACGGTGTCTGAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1128s1c1
Sequence:CCGGGAAGGATTCTTATGCTCGCTACTCGAGTAGCGAGCATAAGAATCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1021s1c1
Sequence:CCGGTGGATCAACATAGATGGCAAACTCGAGTTTGCCATCTATGTTGATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003835.1-2040s1c1
Sequence:CCGGCAAAGTGCATTTGGGTGACATCTCGAGATGTCACCCAAATGCACTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-696s1c1
Sequence:CCGGGTTCTCATCCAACGATGCCATCTCGAGATGGCATCGTTGGATGAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1782s1c1
Sequence:CCGGGCTGCCACGATTGAAATCCAACTCGAGTTGGATTTCAATCGTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-1101s21c1
Sequence:CCGGGCCTTCAACTTCAGCGAATTGCTCGAGCAATTCGCTGAAGTTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003835
RGS9 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-572s21c1
Sequence:CCGGCTATCTGGCCAAGCGAAATATCTCGAGATATTTCGCTTGGCCAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-506s21c1
Sequence:CCGGCAGATTTCAGACACCGTATTTCTCGAGAAATACGGTGTCTGAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1128s1c1
Sequence:CCGGGAAGGATTCTTATGCTCGCTACTCGAGTAGCGAGCATAAGAATCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1021s1c1
Sequence:CCGGTGGATCAACATAGATGGCAAACTCGAGTTTGCCATCTATGTTGATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003835.1-2040s1c1
Sequence:CCGGCAAAGTGCATTTGGGTGACATCTCGAGATGTCACCCAAATGCACTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-696s1c1
Sequence:CCGGGTTCTCATCCAACGATGCCATCTCGAGATGGCATCGTTGGATGAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1782s1c1
Sequence:CCGGGCTGCCACGATTGAAATCCAACTCGAGTTGGATTTCAATCGTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-1101s21c1
Sequence:CCGGGCCTTCAACTTCAGCGAATTGCTCGAGCAATTCGCTGAAGTTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003835
RGS9 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-572s21c1
Sequence:CCGGCTATCTGGCCAAGCGAAATATCTCGAGATATTTCGCTTGGCCAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-506s21c1
Sequence:CCGGCAGATTTCAGACACCGTATTTCTCGAGAAATACGGTGTCTGAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1128s1c1
Sequence:CCGGGAAGGATTCTTATGCTCGCTACTCGAGTAGCGAGCATAAGAATCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1021s1c1
Sequence:CCGGTGGATCAACATAGATGGCAAACTCGAGTTTGCCATCTATGTTGATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003835.1-2040s1c1
Sequence:CCGGCAAAGTGCATTTGGGTGACATCTCGAGATGTCACCCAAATGCACTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-696s1c1
Sequence:CCGGGTTCTCATCCAACGATGCCATCTCGAGATGGCATCGTTGGATGAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003835.1-1782s1c1
Sequence:CCGGGCTGCCACGATTGAAATCCAACTCGAGTTGGATTTCAATCGTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003835.3-1101s21c1
Sequence:CCGGGCCTTCAACTTCAGCGAATTGCTCGAGCAATTCGCTGAAGTTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011268
RGS9 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011268.1-2248s1c1
Sequence:CCGGCCCAAGTGCATTAGGATAATACTCGAGTATTATCCTAATGCACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-446s1c1
Sequence:CCGGCCGATTTCAGACGCCATATTTCTCGAGAAATATGGCGTCTGAAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-2004s1c1
Sequence:CCGGCCCAAGAAAGTAGCCAACTTTCTCGAGAAAGTTGGCTACTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-935s1c1
Sequence:CCGGCCTTCCAAGCAATCCTTGGATCTCGAGATCCAAGGATTGCTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011268
RGS9 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011268.1-2248s1c1
Sequence:CCGGCCCAAGTGCATTAGGATAATACTCGAGTATTATCCTAATGCACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-446s1c1
Sequence:CCGGCCGATTTCAGACGCCATATTTCTCGAGAAATATGGCGTCTGAAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-2004s1c1
Sequence:CCGGCCCAAGAAAGTAGCCAACTTTCTCGAGAAAGTTGGCTACTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-935s1c1
Sequence:CCGGCCTTCCAAGCAATCCTTGGATCTCGAGATCCAAGGATTGCTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011268
RGS9 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011268.1-2248s1c1
Sequence:CCGGCCCAAGTGCATTAGGATAATACTCGAGTATTATCCTAATGCACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-446s1c1
Sequence:CCGGCCGATTTCAGACGCCATATTTCTCGAGAAATATGGCGTCTGAAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-2004s1c1
Sequence:CCGGCCCAAGAAAGTAGCCAACTTTCTCGAGAAAGTTGGCTACTTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011268.1-935s1c1
Sequence:CCGGCCTTCCAAGCAATCCTTGGATCTCGAGATCCAAGGATTGCTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)