EMAIL THIS PAGE TO A FRIEND

RGS9BP

regulator of G protein signaling 9 binding protein

130 Gene Product Result for
Synonyms: PERRS R9AP RGS9
UniProtKB ID: Q6ZS82, Q6ZVJ6
Gene ID:
Human(388531) Summary: The protein encoded by this gene functions as a regulator of G protein-coupled receptor signaling in phototransduction. Studies in bovine and mouse show that this gene is expressed only in the retina, and is localized in the rod outer segment membranes. This protein is associated with a heterotetrameric complex, specifically interacting with the regulator of G-protein signaling 9, and appears to function as the membrane anchor for the other largely soluble interacting partners. Mutations in this gene are associated with prolonged electroretinal response suppression (PERRS), also known as bradyopsia. [provided by RefSeq, Mar 2010]
Mouse(243923) regulator of G-protein signalling 9 binding protein
Rat(499132) regulator of G protein signaling 9 binding protein
Zebrafish(562687) regulator of G-protein signalling 9 binding protein
chicken(395170) regulator of G protein signaling 9 binding protein
dog(612699) regulator of G protein signaling 9 binding protein
cow(282338) regulator of G protein signaling 9 binding protein
sheep(101109036) regulator of G protein signaling 9 binding protein
domestic guinea pig(100731448) regulator of G protein signaling 9 binding protein
naked mole-rat(101718614) regulator of G protein signaling 9 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371159 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038361 MISSION® esiRNA esiRNA targeting mouse Rgs9bp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207391 Rosetta Predictions human pricing
NM_001109142 Rosetta Predictions rat pricing
NM_145840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067824 predicted 2059
2 SASI_Hs01_00067825 predicted 1765
3 SASI_Hs01_00067826 predicted 1833
4 SASI_Hs01_00067827 predicted 1992
5 SASI_Hs01_00067828 predicted 1870
6 SASI_Hs01_00067829 predicted 1839
7 SASI_Hs01_00067832 predicted 1327
8 SASI_Hs01_00067833 predicted 949
9 SASI_Hs02_00373994 predicted 1831
10 SASI_Hs02_00373995 predicted 1832
11 SASI_Hs01_00067830 predicted 1926
12 SASI_Hs01_00067831 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245540 predicted 398
2 SASI_Rn02_00245541 predicted 206
3 SASI_Rn02_00245542 predicted 418
4 SASI_Rn02_00245543 predicted 317
5 SASI_Rn02_00245544 predicted 213
6 SASI_Rn02_00245545 predicted 206
7 SASI_Rn02_00245546 predicted 318
8 SASI_Rn02_00245547 predicted 412
9 SASI_Rn02_00245548 predicted 320
10 SASI_Rn02_00245549 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341322 predicted 938
2 SASI_Mm01_00194158 predicted 1291
3 SASI_Mm01_00194159 predicted 1125
4 SASI_Mm01_00194160 predicted 1053
5 SASI_Mm01_00194161 predicted 1499
6 SASI_Mm01_00194162 predicted 1387
7 SASI_Mm01_00194164 predicted 414
8 SASI_Mm01_00194165 predicted 773
9 SASI_Mm01_00194166 predicted 1168
10 SASI_Mm01_00194167 predicted 1048
11 SASI_Mm01_00194163 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207391
RGS9BP MISSION shRNA Bacterial Glycerol Stock
regulator of G protein signaling 9 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2721s1c1
Sequence:CCGGCGTGTACTATGAAAGCTGTTACTCGAGTAACAGCTTTCATAGTACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2106s1c1
Sequence:CCGGGCAGTTCATACAAAGGGCTTTCTCGAGAAAGCCCTTTGTATGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1337s1c1
Sequence:CCGGGATCGACAACATGGAGATGAACTCGAGTTCATCTCCATGTTGTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207391.1-1331s1c1
Sequence:CCGGCGAGATGATCGACAACATGGACTCGAGTCCATGTTGTCGATCATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2436s1c1
Sequence:CCGGCCAGAGTGTTTGAACCTCCTTCTCGAGAAGGAGGTTCAAACACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1341s1c1
Sequence:CCGGGACAACATGGAGATGAAGGTCCTCGAGGACCTTCATCTCCATGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-1319s21c1
Sequence:CCGGCCTTCAGGTGGGCGAGATGATCTCGAGATCATCTCGCCCACCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-896s21c1
Sequence:CCGGCAACAAGACGACTGCGTGCTACTCGAGTAGCACGCAGTCGTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1984s21c1
Sequence:CCGGGGGACGCTGTTTGGTTCTATGCTCGAGCATAGAACCAAACAGCGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1820s21c1
Sequence:CCGGACCGTCACAGTGACCCTAGATCTCGAGATCTAGGGTCACTGTGACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207391
RGS9BP MISSION shRNA shRNA Plasmid DNA
regulator of G protein signaling 9 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2721s1c1
Sequence:CCGGCGTGTACTATGAAAGCTGTTACTCGAGTAACAGCTTTCATAGTACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2106s1c1
Sequence:CCGGGCAGTTCATACAAAGGGCTTTCTCGAGAAAGCCCTTTGTATGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1337s1c1
Sequence:CCGGGATCGACAACATGGAGATGAACTCGAGTTCATCTCCATGTTGTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207391.1-1331s1c1
Sequence:CCGGCGAGATGATCGACAACATGGACTCGAGTCCATGTTGTCGATCATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2436s1c1
Sequence:CCGGCCAGAGTGTTTGAACCTCCTTCTCGAGAAGGAGGTTCAAACACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1341s1c1
Sequence:CCGGGACAACATGGAGATGAAGGTCCTCGAGGACCTTCATCTCCATGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-1319s21c1
Sequence:CCGGCCTTCAGGTGGGCGAGATGATCTCGAGATCATCTCGCCCACCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-896s21c1
Sequence:CCGGCAACAAGACGACTGCGTGCTACTCGAGTAGCACGCAGTCGTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1984s21c1
Sequence:CCGGGGGACGCTGTTTGGTTCTATGCTCGAGCATAGAACCAAACAGCGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1820s21c1
Sequence:CCGGACCGTCACAGTGACCCTAGATCTCGAGATCTAGGGTCACTGTGACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207391
RGS9BP MISSION shRNA Lentiviral Transduction Particles
regulator of G protein signaling 9 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2721s1c1
Sequence:CCGGCGTGTACTATGAAAGCTGTTACTCGAGTAACAGCTTTCATAGTACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2106s1c1
Sequence:CCGGGCAGTTCATACAAAGGGCTTTCTCGAGAAAGCCCTTTGTATGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1337s1c1
Sequence:CCGGGATCGACAACATGGAGATGAACTCGAGTTCATCTCCATGTTGTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207391.1-1331s1c1
Sequence:CCGGCGAGATGATCGACAACATGGACTCGAGTCCATGTTGTCGATCATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207391.1-2436s1c1
Sequence:CCGGCCAGAGTGTTTGAACCTCCTTCTCGAGAAGGAGGTTCAAACACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207391.1-1341s1c1
Sequence:CCGGGACAACATGGAGATGAAGGTCCTCGAGGACCTTCATCTCCATGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-1319s21c1
Sequence:CCGGCCTTCAGGTGGGCGAGATGATCTCGAGATCATCTCGCCCACCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207391.2-896s21c1
Sequence:CCGGCAACAAGACGACTGCGTGCTACTCGAGTAGCACGCAGTCGTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1984s21c1
Sequence:CCGGGGGACGCTGTTTGGTTCTATGCTCGAGCATAGAACCAAACAGCGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207391.2-1820s21c1
Sequence:CCGGACCGTCACAGTGACCCTAGATCTCGAGATCTAGGGTCACTGTGACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145840
RGS9BP MISSION shRNA Bacterial Glycerol Stock
regulator of G protein signaling 9 binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-810s1c1
Sequence:CCGGCGACATGGAAATGAAAGTCAACTCGAGTTGACTTTCATTTCCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-912s1c1
Sequence:CCGGCGGTGGCATTTCGGTAGAGGACTCGAGTCCTCTACCGAAATGCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-595s1c1
Sequence:CCGGGCCGACATGCAGCGCGCACTACTCGAGTAGTGCGCGCTGCATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-380s1c1
Sequence:CCGGGCTACCATCACTTAGTGCTTACTCGAGTAAGCACTAAGTGATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-1008s1c1
Sequence:CCGGCCTCGCCTTATGTGTGGCAAACTCGAGTTTGCCACACATAAGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145840
RGS9BP MISSION shRNA shRNA Plasmid DNA
regulator of G protein signaling 9 binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-810s1c1
Sequence:CCGGCGACATGGAAATGAAAGTCAACTCGAGTTGACTTTCATTTCCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-912s1c1
Sequence:CCGGCGGTGGCATTTCGGTAGAGGACTCGAGTCCTCTACCGAAATGCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-595s1c1
Sequence:CCGGGCCGACATGCAGCGCGCACTACTCGAGTAGTGCGCGCTGCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-380s1c1
Sequence:CCGGGCTACCATCACTTAGTGCTTACTCGAGTAAGCACTAAGTGATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-1008s1c1
Sequence:CCGGCCTCGCCTTATGTGTGGCAAACTCGAGTTTGCCACACATAAGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145840
RGS9BP MISSION shRNA Lentiviral Transduction Particles
regulator of G protein signaling 9 binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-810s1c1
Sequence:CCGGCGACATGGAAATGAAAGTCAACTCGAGTTGACTTTCATTTCCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-912s1c1
Sequence:CCGGCGGTGGCATTTCGGTAGAGGACTCGAGTCCTCTACCGAAATGCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-595s1c1
Sequence:CCGGGCCGACATGCAGCGCGCACTACTCGAGTAGTGCGCGCTGCATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-380s1c1
Sequence:CCGGGCTACCATCACTTAGTGCTTACTCGAGTAAGCACTAAGTGATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145840.2-1008s1c1
Sequence:CCGGCCTCGCCTTATGTGTGGCAAACTCGAGTTTGCCACACATAAGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371159
RGS9BP MISSION shRNA Bacterial Glycerol Stock
regulator of G protein signaling 9 binding protein
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000121800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371159.2-1841s1c1
Sequence:CCGGCCCTCCGAGTTAATGAGTTAACTCGAGTTAACTCATTAACTCGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371159.2-1343s1c1
Sequence:CCGGCAACATGGAGATGAAGGTCAACTCGAGTTGACCTTCATCTCCATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371159
RGS9BP MISSION shRNA shRNA Plasmid DNA
regulator of G protein signaling 9 binding protein
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000121800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371159.2-1841s1c1
Sequence:CCGGCCCTCCGAGTTAATGAGTTAACTCGAGTTAACTCATTAACTCGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371159.2-1343s1c1
Sequence:CCGGCAACATGGAGATGAAGGTCAACTCGAGTTGACCTTCATCTCCATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371159
RGS9BP MISSION shRNA Lentiviral Transduction Particles
regulator of G protein signaling 9 binding protein
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000121800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371159.2-1841s1c1
Sequence:CCGGCCCTCCGAGTTAATGAGTTAACTCGAGTTAACTCATTAACTCGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371159.2-1343s1c1
Sequence:CCGGCAACATGGAGATGAAGGTCAACTCGAGTTGACCTTCATCTCCATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)